Incidental Mutation 'R1013:4930527J03Rik'
List |< first << previous [record 80 of 1920] next >> last >|
ID95821
Institutional Source Beutler Lab
Gene Symbol 4930527J03Rik
Ensembl Gene ENSMUSG00000070489
Gene NameRIKEN cDNA 4930527J03 gene
Synonyms
MMRRC Submission 039117-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R1013 (G1)
Quality Score109
Status Validated
Chromosome1
Chromosomal Location178276047-178276641 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) ACCC to ACC at 178276503 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192920
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.4%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
Bclaf1 T A 10: 20,332,076 probably benign Het
Bicdl2 A G 17: 23,665,403 probably benign Het
C8a T C 4: 104,828,039 I336V probably benign Het
Calcr A T 6: 3,692,621 V374D probably damaging Het
Col28a1 A G 6: 7,999,452 probably benign Het
Cuedc1 C T 11: 88,188,027 A327V possibly damaging Het
Cul2 C A 18: 3,425,535 Y378* probably null Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm8369 TG TGNG 19: 11,511,783 probably null Het
Hivep1 A G 13: 42,156,962 R893G probably damaging Het
Il10rb A G 16: 91,414,693 N140D probably benign Het
Itga4 A G 2: 79,320,503 M818V probably benign Het
Kyat3 T C 3: 142,726,246 I245T probably damaging Het
Lck C T 4: 129,558,127 C20Y probably damaging Het
Mcm6 T G 1: 128,349,041 S271R probably benign Het
Megf10 A G 18: 57,261,219 I472V probably benign Het
Mroh2a T C 1: 88,234,612 probably null Het
Mrpl11 T C 19: 4,963,623 I144T possibly damaging Het
Olfr1061 G A 2: 86,413,975 P26S possibly damaging Het
Olfr1395 G A 11: 49,149,150 V298M probably damaging Het
Pcdhb17 A G 18: 37,485,967 D270G probably damaging Het
Plg G A 17: 12,378,721 probably benign Het
Ppp3cb T A 14: 20,524,004 E255D probably benign Het
Psenen A G 7: 30,562,377 F38S possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sorl1 T C 9: 42,002,559 N1358S probably benign Het
Trim3 G A 7: 105,617,895 P426S probably benign Het
Ttc28 T C 5: 111,276,965 M1552T probably benign Het
Unc13c T C 9: 73,933,332 D79G probably benign Het
Wdr92 A G 11: 17,228,183 K226E probably damaging Het
Zcchc14 A G 8: 121,606,925 probably benign Het
Zfp354a T C 11: 51,060,850 probably benign Het
Zfp729a T C 13: 67,619,507 I868V probably benign Het
Other mutations in 4930527J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0294:4930527J03Rik UTSW 1 178276503 exon noncoding transcript
R0323:4930527J03Rik UTSW 1 178276503 exon noncoding transcript
R0392:4930527J03Rik UTSW 1 178276503 exon noncoding transcript
R1247:4930527J03Rik UTSW 1 178276503 exon noncoding transcript
R4804:4930527J03Rik UTSW 1 178276109 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCACCTGCTCAACAAAGCTGATTTC -3'
(R):5'- AGTGCTTCCTCCAGAACTAGGCTG -3'

Sequencing Primer
(F):5'- GAGAACTTGCCCTTCCTccg -3'
(R):5'- TCCAGAACTAGGCTGCTATTG -3'
Posted On2014-01-05