Incidental Mutation 'R1123:Nckap1'
ID95822
Institutional Source Beutler Lab
Gene Symbol Nckap1
Ensembl Gene ENSMUSG00000027002
Gene NameNCK-associated protein 1
Synonymsmh19, Hem-2, Nap1, Hem2, H19
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location80500512-80581380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80517942 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 889 (S889N)
Ref Sequence ENSEMBL: ENSMUSP00000107390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028386] [ENSMUST00000111760]
Predicted Effect probably benign
Transcript: ENSMUST00000028386
AA Change: S883N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028386
Gene: ENSMUSG00000027002
AA Change: S883N

DomainStartEndE-ValueType
Pfam:Nckap1 8 1124 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111760
AA Change: S889N

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107390
Gene: ENSMUSG00000027002
AA Change: S889N

DomainStartEndE-ValueType
Pfam:Nckap1 9 1128 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154793
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit growth arrest at midgestation, an open neural tube, cardia bifida, defective foregut development, defects in endoderm and mesoderm migration and sometimes duplication of the anteroposterior body axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Nckap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nckap1 APN 2 80506202 missense possibly damaging 0.87
IGL00896:Nckap1 APN 2 80580953 missense possibly damaging 0.59
IGL01343:Nckap1 APN 2 80519842 missense possibly damaging 0.81
IGL01593:Nckap1 APN 2 80520570 missense probably benign 0.06
IGL01677:Nckap1 APN 2 80530297 missense probably benign 0.04
IGL01873:Nckap1 APN 2 80553385 missense possibly damaging 0.95
IGL01874:Nckap1 APN 2 80525636 missense probably damaging 1.00
IGL01947:Nckap1 APN 2 80508753 missense probably damaging 1.00
IGL02268:Nckap1 APN 2 80528618 missense probably benign 0.16
IGL02348:Nckap1 APN 2 80517982 missense probably damaging 1.00
IGL03349:Nckap1 APN 2 80525560 missense probably benign 0.07
PIT4151001:Nckap1 UTSW 2 80520370 critical splice donor site probably null
R0326:Nckap1 UTSW 2 80553370 missense probably benign 0.41
R0345:Nckap1 UTSW 2 80544977 splice site probably benign
R0520:Nckap1 UTSW 2 80541530 splice site probably benign
R0603:Nckap1 UTSW 2 80512729 missense probably benign 0.19
R0924:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0930:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0964:Nckap1 UTSW 2 80547899 critical splice donor site probably null
R1122:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1124:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1125:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1127:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1182:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1234:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1236:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1384:Nckap1 UTSW 2 80533670 missense possibly damaging 0.90
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1511:Nckap1 UTSW 2 80553415 missense probably damaging 0.99
R1677:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1686:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1687:Nckap1 UTSW 2 80520585 missense probably damaging 0.96
R1717:Nckap1 UTSW 2 80512670 splice site probably benign
R1789:Nckap1 UTSW 2 80520556 missense probably benign 0.44
R1822:Nckap1 UTSW 2 80517898 missense possibly damaging 0.58
R1840:Nckap1 UTSW 2 80502250 missense possibly damaging 0.88
R1926:Nckap1 UTSW 2 80506838 missense probably damaging 1.00
R1968:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1970:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R2027:Nckap1 UTSW 2 80535518 missense probably damaging 1.00
R2063:Nckap1 UTSW 2 80570150 missense probably damaging 1.00
R2504:Nckap1 UTSW 2 80530218 missense probably benign 0.40
R3824:Nckap1 UTSW 2 80540560 missense possibly damaging 0.72
R4784:Nckap1 UTSW 2 80506934 missense probably benign 0.15
R4908:Nckap1 UTSW 2 80523374 critical splice donor site probably null
R5077:Nckap1 UTSW 2 80548933 missense probably damaging 0.99
R5311:Nckap1 UTSW 2 80540122 missense probably damaging 1.00
R5439:Nckap1 UTSW 2 80512690 missense possibly damaging 0.81
R6141:Nckap1 UTSW 2 80530207 missense probably damaging 1.00
R6209:Nckap1 UTSW 2 80525602 missense probably damaging 1.00
R6226:Nckap1 UTSW 2 80508781 missense possibly damaging 0.96
R6294:Nckap1 UTSW 2 80541514 missense probably benign 0.03
R6458:Nckap1 UTSW 2 80512549 intron probably null
R6937:Nckap1 UTSW 2 80508716 missense probably damaging 1.00
R6986:Nckap1 UTSW 2 80520567 missense probably benign 0.03
R7180:Nckap1 UTSW 2 80506892 missense probably benign 0.01
R7208:Nckap1 UTSW 2 80540198 missense probably benign 0.24
R7363:Nckap1 UTSW 2 80540168 missense probably damaging 1.00
R7448:Nckap1 UTSW 2 80524541 missense probably damaging 1.00
R7513:Nckap1 UTSW 2 80502291 missense not run
Predicted Primers PCR Primer
(F):5'- GGAGTAGATGTACACTGGAAAGACCCT -3'
(R):5'- GGTCACAAAACCTCTTGGAACTTGACA -3'

Sequencing Primer
(F):5'- GTACACTGGAAAGACCCTGTGAC -3'
(R):5'- AGAACAAAGATCCGTGCCTG -3'
Posted On2014-01-05