Incidental Mutation 'R1123:Olfr1225'
ID95826
Institutional Source Beutler Lab
Gene Symbol Olfr1225
Ensembl Gene ENSMUSG00000101918
Gene Nameolfactory receptor 1225
SynonymsMOR233-11, GA_x6K02T2Q125-50650037-50649102
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89168380-89174669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89170868 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 115 (S115P)
Ref Sequence ENSEMBL: ENSMUSP00000150915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188861] [ENSMUST00000216961] [ENSMUST00000217054]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099791
AA Change: S115P

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097379
Gene: ENSMUSG00000075098
AA Change: S115P

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4e-47 PFAM
Pfam:7tm_1 39 304 2.7e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188861
AA Change: S115P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140442
Gene: ENSMUSG00000101918
AA Change: S115P

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
Pfam:7tm_1 39 289 5.5e-24 PFAM
Pfam:7tm_4 138 287 2.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216961
AA Change: S115P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217054
AA Change: S115P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Evi5 T G 5: 107,820,578 I184L probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Olfr1225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Olfr1225 APN 2 89171089 missense possibly damaging 0.53
IGL03381:Olfr1225 APN 2 89171179 missense possibly damaging 0.49
IGL03147:Olfr1225 UTSW 2 89170972 missense probably benign 0.03
R0100:Olfr1225 UTSW 2 89171087 missense probably benign 0.00
R0373:Olfr1225 UTSW 2 89170413 missense probably benign 0.02
R0482:Olfr1225 UTSW 2 89170631 missense probably benign 0.37
R0491:Olfr1225 UTSW 2 89170360 missense probably benign 0.07
R0548:Olfr1225 UTSW 2 89170648 missense probably damaging 1.00
R1511:Olfr1225 UTSW 2 89170937 missense probably damaging 1.00
R1565:Olfr1225 UTSW 2 89170627 missense probably benign 0.01
R4204:Olfr1225 UTSW 2 89170780 missense probably benign 0.13
R4580:Olfr1225 UTSW 2 89171200 missense probably benign 0.01
R4669:Olfr1225 UTSW 2 89170901 missense probably damaging 1.00
R5137:Olfr1225 UTSW 2 89170400 missense probably benign 0.00
R6391:Olfr1225 UTSW 2 89170598 missense probably benign 0.03
R6396:Olfr1225 UTSW 2 89170690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCAGTGCAGGCAAGCTTCAG -3'
(R):5'- TGTGGTGACCATCATCTACAGCCC -3'

Sequencing Primer
(F):5'- CTTCAGTAATGGGAACAAGTCAC -3'
(R):5'- ATCATCTACAGCCCTGCACTG -3'
Posted On2014-01-05