Incidental Mutation 'R1013:Col28a1'
ID95866
Institutional Source Beutler Lab
Gene Symbol Col28a1
Ensembl Gene ENSMUSG00000068794
Gene Namecollagen, type XXVIII, alpha 1
SynonymsCol28; Gm466
MMRRC Submission 039117-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1013 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location7997808-8192617 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 7999452 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115537]
Predicted Effect probably benign
Transcript: ENSMUST00000115537
SMART Domains Protein: ENSMUSP00000111199
Gene: ENSMUSG00000068794

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 46 225 8.08e-18 SMART
low complexity region 245 260 N/A INTRINSIC
internal_repeat_1 261 304 1.56e-15 PROSPERO
low complexity region 306 363 N/A INTRINSIC
low complexity region 375 422 N/A INTRINSIC
low complexity region 438 479 N/A INTRINSIC
internal_repeat_4 481 531 4.11e-8 PROSPERO
Pfam:Collagen 534 591 1.5e-8 PFAM
low complexity region 640 661 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
internal_repeat_4 690 739 4.11e-8 PROSPERO
internal_repeat_1 711 763 1.56e-15 PROSPERO
internal_repeat_5 713 769 4.35e-6 PROSPERO
low complexity region 771 789 N/A INTRINSIC
VWA 796 973 1.57e-38 SMART
KU 1086 1139 8.16e-20 SMART
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.4%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL28A1 belongs to a class of collagens containing von Willebrand factor (VWF; MIM 613160) type A (VWFA) domains (Veit et al., 2006 [PubMed 16330543]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bclaf1 T A 10: 20,332,076 probably benign Het
Bicdl2 A G 17: 23,665,403 probably benign Het
C8a T C 4: 104,828,039 I336V probably benign Het
Calcr A T 6: 3,692,621 V374D probably damaging Het
Cuedc1 C T 11: 88,188,027 A327V possibly damaging Het
Cul2 C A 18: 3,425,535 Y378* probably null Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm8369 TG TGNG 19: 11,511,783 probably null Het
Hivep1 A G 13: 42,156,962 R893G probably damaging Het
Il10rb A G 16: 91,414,693 N140D probably benign Het
Itga4 A G 2: 79,320,503 M818V probably benign Het
Kyat3 T C 3: 142,726,246 I245T probably damaging Het
Lck C T 4: 129,558,127 C20Y probably damaging Het
Mcm6 T G 1: 128,349,041 S271R probably benign Het
Megf10 A G 18: 57,261,219 I472V probably benign Het
Mroh2a T C 1: 88,234,612 probably null Het
Mrpl11 T C 19: 4,963,623 I144T possibly damaging Het
Olfr1061 G A 2: 86,413,975 P26S possibly damaging Het
Olfr1395 G A 11: 49,149,150 V298M probably damaging Het
Pcdhb17 A G 18: 37,485,967 D270G probably damaging Het
Plg G A 17: 12,378,721 probably benign Het
Ppp3cb T A 14: 20,524,004 E255D probably benign Het
Psenen A G 7: 30,562,377 F38S possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sorl1 T C 9: 42,002,559 N1358S probably benign Het
Trim3 G A 7: 105,617,895 P426S probably benign Het
Ttc28 T C 5: 111,276,965 M1552T probably benign Het
Unc13c T C 9: 73,933,332 D79G probably benign Het
Wdr92 A G 11: 17,228,183 K226E probably damaging Het
Zcchc14 A G 8: 121,606,925 probably benign Het
Zfp354a T C 11: 51,060,850 probably benign Het
Zfp729a T C 13: 67,619,507 I868V probably benign Het
Other mutations in Col28a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Col28a1 APN 6 8014795 missense probably damaging 1.00
IGL00329:Col28a1 APN 6 8175425 missense probably damaging 1.00
IGL00466:Col28a1 APN 6 8022081 splice site probably benign
IGL00544:Col28a1 APN 6 8162228 critical splice acceptor site probably null
IGL00979:Col28a1 APN 6 8014810 missense probably damaging 1.00
IGL01475:Col28a1 APN 6 8103521 missense probably damaging 0.98
IGL01570:Col28a1 APN 6 8014540 missense probably damaging 0.99
IGL01688:Col28a1 APN 6 7998517 missense probably damaging 1.00
IGL01734:Col28a1 APN 6 8158134 missense probably damaging 0.99
IGL01911:Col28a1 APN 6 8014963 missense probably damaging 1.00
IGL01922:Col28a1 APN 6 8158133 missense probably damaging 0.96
IGL02567:Col28a1 APN 6 8014819 missense possibly damaging 0.91
IGL02641:Col28a1 APN 6 8014794 nonsense probably null
IGL02893:Col28a1 APN 6 8103534 missense probably damaging 1.00
IGL03062:Col28a1 APN 6 8017029 splice site probably benign
IGL03273:Col28a1 APN 6 8103484 splice site probably benign
P0043:Col28a1 UTSW 6 8168152 unclassified probably benign
R0034:Col28a1 UTSW 6 8175708 missense probably benign 0.32
R0543:Col28a1 UTSW 6 8075326 splice site probably benign
R0646:Col28a1 UTSW 6 8175291 missense possibly damaging 0.88
R0726:Col28a1 UTSW 6 8014495 critical splice donor site probably null
R1054:Col28a1 UTSW 6 8175534 missense probably damaging 0.96
R1671:Col28a1 UTSW 6 8083773 missense possibly damaging 0.84
R1804:Col28a1 UTSW 6 8164612 critical splice donor site probably null
R1853:Col28a1 UTSW 6 8014574 missense probably benign 0.03
R1906:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R1914:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1915:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1954:Col28a1 UTSW 6 7998516 missense probably damaging 1.00
R1997:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R2011:Col28a1 UTSW 6 8059360 missense probably benign 0.05
R2023:Col28a1 UTSW 6 8083783 missense possibly damaging 0.66
R2149:Col28a1 UTSW 6 8155383 missense possibly damaging 0.83
R2285:Col28a1 UTSW 6 8097078 missense probably damaging 0.98
R2403:Col28a1 UTSW 6 8175641 missense possibly damaging 0.79
R3615:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3616:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3837:Col28a1 UTSW 6 8014601 missense possibly damaging 0.81
R4042:Col28a1 UTSW 6 8014678 missense probably damaging 0.98
R4084:Col28a1 UTSW 6 8013131 nonsense probably null
R4084:Col28a1 UTSW 6 8013132 missense possibly damaging 0.49
R4417:Col28a1 UTSW 6 8175666 missense possibly damaging 0.62
R4838:Col28a1 UTSW 6 8014559 missense probably benign 0.11
R5752:Col28a1 UTSW 6 8015025 missense possibly damaging 0.79
R5807:Col28a1 UTSW 6 8158144 missense probably benign 0.00
R6038:Col28a1 UTSW 6 8013140 missense probably benign 0.03
R6038:Col28a1 UTSW 6 8013140 missense probably benign 0.03
R6046:Col28a1 UTSW 6 8168102 splice site probably null
R6054:Col28a1 UTSW 6 8083748 missense possibly damaging 0.96
R6159:Col28a1 UTSW 6 8162247 intron probably null
R6306:Col28a1 UTSW 6 8014969 missense probably damaging 0.96
R6379:Col28a1 UTSW 6 8012996 missense probably benign 0.00
R6665:Col28a1 UTSW 6 8062277 missense probably benign 0.08
R6809:Col28a1 UTSW 6 7999468 missense probably damaging 0.99
R7023:Col28a1 UTSW 6 8083763 missense possibly damaging 0.92
R7101:Col28a1 UTSW 6 8014795 missense possibly damaging 0.95
R7117:Col28a1 UTSW 6 8013122 missense possibly damaging 0.89
R7375:Col28a1 UTSW 6 7998499 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGGAAAGGAACAGATTTCCACAACTCC -3'
(R):5'- ACTGAATCGTATGTGTTGACTGAGGC -3'

Sequencing Primer
(F):5'- CATCTAAGCTCCTATCGGAGTTGG -3'
(R):5'- TTGACTGAGGCTGGTATCTTG -3'
Posted On2014-01-05