Incidental Mutation 'R1013:Wdr92'
ID95894
Institutional Source Beutler Lab
Gene Symbol Wdr92
Ensembl Gene ENSMUSG00000078970
Gene NameWD repeat domain 92
Synonyms
MMRRC Submission 039117-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R1013 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location17182107-17233796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17228183 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 226 (K226E)
Ref Sequence ENSEMBL: ENSMUSP00000040938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046955]
Predicted Effect probably damaging
Transcript: ENSMUST00000046955
AA Change: K226E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040938
Gene: ENSMUSG00000078970
AA Change: K226E

DomainStartEndE-ValueType
WD40 55 96 6.88e0 SMART
WD40 100 145 5.15e-2 SMART
Blast:WD40 149 196 8e-27 BLAST
WD40 199 240 2.54e2 SMART
WD40 246 288 2.06e0 SMART
WD40 310 350 7.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151431
Meta Mutation Damage Score 0.378 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.4%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two WD40 repeat domains thought to be involved in an apoptosis via activation of caspase-3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bclaf1 T A 10: 20,332,076 probably benign Het
Bicdl2 A G 17: 23,665,403 probably benign Het
C8a T C 4: 104,828,039 I336V probably benign Het
Calcr A T 6: 3,692,621 V374D probably damaging Het
Col28a1 A G 6: 7,999,452 probably benign Het
Cuedc1 C T 11: 88,188,027 A327V possibly damaging Het
Cul2 C A 18: 3,425,535 Y378* probably null Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm8369 TG TGNG 19: 11,511,783 probably null Het
Hivep1 A G 13: 42,156,962 R893G probably damaging Het
Il10rb A G 16: 91,414,693 N140D probably benign Het
Itga4 A G 2: 79,320,503 M818V probably benign Het
Kyat3 T C 3: 142,726,246 I245T probably damaging Het
Lck C T 4: 129,558,127 C20Y probably damaging Het
Mcm6 T G 1: 128,349,041 S271R probably benign Het
Megf10 A G 18: 57,261,219 I472V probably benign Het
Mroh2a T C 1: 88,234,612 probably null Het
Mrpl11 T C 19: 4,963,623 I144T possibly damaging Het
Olfr1061 G A 2: 86,413,975 P26S possibly damaging Het
Olfr1395 G A 11: 49,149,150 V298M probably damaging Het
Pcdhb17 A G 18: 37,485,967 D270G probably damaging Het
Plg G A 17: 12,378,721 probably benign Het
Ppp3cb T A 14: 20,524,004 E255D probably benign Het
Psenen A G 7: 30,562,377 F38S possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sorl1 T C 9: 42,002,559 N1358S probably benign Het
Trim3 G A 7: 105,617,895 P426S probably benign Het
Ttc28 T C 5: 111,276,965 M1552T probably benign Het
Unc13c T C 9: 73,933,332 D79G probably benign Het
Zcchc14 A G 8: 121,606,925 probably benign Het
Zfp354a T C 11: 51,060,850 probably benign Het
Zfp729a T C 13: 67,619,507 I868V probably benign Het
Other mutations in Wdr92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Wdr92 APN 11 17232790 missense probably benign
IGL01801:Wdr92 APN 11 17219015 missense probably benign 0.00
IGL02573:Wdr92 APN 11 17212136 missense possibly damaging 0.92
IGL02985:Wdr92 APN 11 17229845 missense probably damaging 1.00
IGL03148:Wdr92 APN 11 17229845 missense probably damaging 1.00
IGL03147:Wdr92 UTSW 11 17229845 missense probably damaging 1.00
R0244:Wdr92 UTSW 11 17229851 missense probably damaging 1.00
R0276:Wdr92 UTSW 11 17229821 missense probably benign 0.33
R1660:Wdr92 UTSW 11 17227183 missense probably benign 0.00
R2030:Wdr92 UTSW 11 17229832 missense probably benign
R4663:Wdr92 UTSW 11 17232853 missense probably benign 0.01
R4676:Wdr92 UTSW 11 17229794 missense probably benign 0.00
R4822:Wdr92 UTSW 11 17227165 missense probably damaging 1.00
R5328:Wdr92 UTSW 11 17222220 missense probably damaging 0.97
R5439:Wdr92 UTSW 11 17212031 missense possibly damaging 0.46
R5473:Wdr92 UTSW 11 17224591 missense probably damaging 0.99
R5642:Wdr92 UTSW 11 17227263 missense possibly damaging 0.89
R5771:Wdr92 UTSW 11 17224638 missense probably benign 0.00
R6680:Wdr92 UTSW 11 17229857 missense probably damaging 1.00
R6889:Wdr92 UTSW 11 17222309 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGGGAACCCAGATGGCTTTAC -3'
(R):5'- GATCCCACAAGTACATGGCAGACAG -3'

Sequencing Primer
(F):5'- accatctgtaactccacttcc -3'
(R):5'- TACATGGCAGACAGAGGAAGC -3'
Posted On2014-01-05