Incidental Mutation 'R1013:Cuedc1'
ID95903
Institutional Source Beutler Lab
Gene Symbol Cuedc1
Ensembl Gene ENSMUSG00000018378
Gene NameCUE domain containing 1
SynonymsC330016O16Rik
MMRRC Submission 039117-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1013 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location88098058-88194140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88188027 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 327 (A327V)
Ref Sequence ENSEMBL: ENSMUSP00000018522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018522] [ENSMUST00000154812]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018522
AA Change: A327V

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018522
Gene: ENSMUSG00000018378
AA Change: A327V

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
CUE 50 92 6.55e-15 SMART
low complexity region 94 110 N/A INTRINSIC
low complexity region 121 136 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
low complexity region 331 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142564
Predicted Effect probably benign
Transcript: ENSMUST00000154812
SMART Domains Protein: ENSMUSP00000120867
Gene: ENSMUSG00000018378

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
CUE 50 92 6.55e-15 SMART
low complexity region 94 110 N/A INTRINSIC
low complexity region 121 136 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.4%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bclaf1 T A 10: 20,332,076 probably benign Het
Bicdl2 A G 17: 23,665,403 probably benign Het
C8a T C 4: 104,828,039 I336V probably benign Het
Calcr A T 6: 3,692,621 V374D probably damaging Het
Col28a1 A G 6: 7,999,452 probably benign Het
Cul2 C A 18: 3,425,535 Y378* probably null Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm8369 TG TGNG 19: 11,511,783 probably null Het
Hivep1 A G 13: 42,156,962 R893G probably damaging Het
Il10rb A G 16: 91,414,693 N140D probably benign Het
Itga4 A G 2: 79,320,503 M818V probably benign Het
Kyat3 T C 3: 142,726,246 I245T probably damaging Het
Lck C T 4: 129,558,127 C20Y probably damaging Het
Mcm6 T G 1: 128,349,041 S271R probably benign Het
Megf10 A G 18: 57,261,219 I472V probably benign Het
Mroh2a T C 1: 88,234,612 probably null Het
Mrpl11 T C 19: 4,963,623 I144T possibly damaging Het
Olfr1061 G A 2: 86,413,975 P26S possibly damaging Het
Olfr1395 G A 11: 49,149,150 V298M probably damaging Het
Pcdhb17 A G 18: 37,485,967 D270G probably damaging Het
Plg G A 17: 12,378,721 probably benign Het
Ppp3cb T A 14: 20,524,004 E255D probably benign Het
Psenen A G 7: 30,562,377 F38S possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sorl1 T C 9: 42,002,559 N1358S probably benign Het
Trim3 G A 7: 105,617,895 P426S probably benign Het
Ttc28 T C 5: 111,276,965 M1552T probably benign Het
Unc13c T C 9: 73,933,332 D79G probably benign Het
Wdr92 A G 11: 17,228,183 K226E probably damaging Het
Zcchc14 A G 8: 121,606,925 probably benign Het
Zfp354a T C 11: 51,060,850 probably benign Het
Zfp729a T C 13: 67,619,507 I868V probably benign Het
Other mutations in Cuedc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Cuedc1 APN 11 88183254 missense possibly damaging 0.56
IGL02103:Cuedc1 APN 11 88188799 missense probably damaging 0.99
IGL02325:Cuedc1 APN 11 88170173 missense probably null 1.00
IGL03001:Cuedc1 APN 11 88182489 missense probably benign 0.02
IGL03245:Cuedc1 APN 11 88177262 splice site probably benign
R0242:Cuedc1 UTSW 11 88184621 splice site probably benign
R0511:Cuedc1 UTSW 11 88183405 missense probably damaging 1.00
R1382:Cuedc1 UTSW 11 88177363 missense probably benign 0.08
R2004:Cuedc1 UTSW 11 88177390 missense probably damaging 1.00
R5320:Cuedc1 UTSW 11 88177310 missense probably damaging 1.00
R5381:Cuedc1 UTSW 11 88187986 splice site probably null
R5782:Cuedc1 UTSW 11 88170032 missense probably damaging 1.00
R6282:Cuedc1 UTSW 11 88183402 missense probably damaging 1.00
R6918:Cuedc1 UTSW 11 88187073 missense probably benign 0.00
R7329:Cuedc1 UTSW 11 88169866 missense unknown
Predicted Primers PCR Primer
(F):5'- ATAGACCCATAACCAGCGGGGATG -3'
(R):5'- TCTCCCAAAATGCAGATGACTTAAGGC -3'

Sequencing Primer
(F):5'- CAGGGAAAATTTCCGATGACTC -3'
(R):5'- GGGTTTCCTGGTTCACAAATCAAG -3'
Posted On2014-01-05