Incidental Mutation 'R1125:Ctns'
ID 96072
Institutional Source Beutler Lab
Gene Symbol Ctns
Ensembl Gene ENSMUSG00000005949
Gene Name cystinosis, nephropathic
Synonyms
MMRRC Submission 039198-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R1125 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 73074422-73089868 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) C to A at 73078663 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006103] [ENSMUST00000006103] [ENSMUST00000006103] [ENSMUST00000006103] [ENSMUST00000108476] [ENSMUST00000108476] [ENSMUST00000108476] [ENSMUST00000108476]
AlphaFold P57757
Predicted Effect probably null
Transcript: ENSMUST00000006103
SMART Domains Protein: ENSMUSP00000006103
Gene: ENSMUSG00000005949

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000006103
SMART Domains Protein: ENSMUSP00000006103
Gene: ENSMUSG00000005949

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000006103
SMART Domains Protein: ENSMUSP00000006103
Gene: ENSMUSG00000005949

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000006103
SMART Domains Protein: ENSMUSP00000006103
Gene: ENSMUSG00000005949

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108476
SMART Domains Protein: ENSMUSP00000104116
Gene: ENSMUSG00000005949

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108476
SMART Domains Protein: ENSMUSP00000104116
Gene: ENSMUSG00000005949

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108476
SMART Domains Protein: ENSMUSP00000104116
Gene: ENSMUSG00000005949

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108476
SMART Domains Protein: ENSMUSP00000104116
Gene: ENSMUSG00000005949

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150468
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased intracellular cystine, progressive accumulation of cystine crystals, occasional muscle impairment, reduced exploratory activity, osteoporosis, and lowered electroretinogram amplitude. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,898,378 (GRCm39) I254T probably benign Het
Abcb5 T C 12: 118,875,282 (GRCm39) D630G possibly damaging Het
Anks4b T G 7: 119,781,580 (GRCm39) F204V possibly damaging Het
Bltp3a T C 17: 28,112,423 (GRCm39) V1204A probably damaging Het
C87436 T C 6: 86,424,344 (GRCm39) V282A probably benign Het
Cav3 T A 6: 112,449,257 (GRCm39) F92I probably damaging Het
Cbs A T 17: 31,851,805 (GRCm39) V66E probably benign Het
Cd226 A G 18: 89,286,046 (GRCm39) I172V probably benign Het
Cimip2b A G 4: 43,427,550 (GRCm39) I258T probably damaging Het
Gid4 A G 11: 60,315,607 (GRCm39) D66G possibly damaging Het
Glra3 A G 8: 56,492,789 (GRCm39) D163G possibly damaging Het
Lrrc23 A G 6: 124,753,145 (GRCm39) V167A probably benign Het
Nbea A T 3: 55,764,427 (GRCm39) L1979* probably null Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Necab1 T A 4: 15,111,257 (GRCm39) D57V probably damaging Het
Or2ag12 T A 7: 106,277,214 (GRCm39) T160S possibly damaging Het
Plekhd1 C A 12: 80,753,998 (GRCm39) Q155K possibly damaging Het
Ppara A G 15: 85,673,256 (GRCm39) N149S possibly damaging Het
Slc30a5 C T 13: 100,939,921 (GRCm39) V665M probably damaging Het
Sntb1 T G 15: 55,612,676 (GRCm39) T301P probably benign Het
Tlr5 A T 1: 182,801,457 (GRCm39) T240S probably benign Het
Ttc5 A G 14: 51,015,335 (GRCm39) L92P probably damaging Het
Ttll10 A G 4: 156,119,495 (GRCm39) S664P possibly damaging Het
Vmn2r45 G A 7: 8,488,542 (GRCm39) R163C probably benign Het
Vmn2r94 T C 17: 18,477,717 (GRCm39) I231M probably damaging Het
Other mutations in Ctns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ctns APN 11 73,079,548 (GRCm39) missense possibly damaging 0.88
IGL02582:Ctns APN 11 73,087,478 (GRCm39) missense probably benign 0.22
R0103:Ctns UTSW 11 73,076,137 (GRCm39) missense probably damaging 1.00
R1333:Ctns UTSW 11 73,075,823 (GRCm39) missense probably benign 0.03
R1422:Ctns UTSW 11 73,076,072 (GRCm39) missense probably damaging 1.00
R1621:Ctns UTSW 11 73,079,298 (GRCm39) missense possibly damaging 0.72
R2104:Ctns UTSW 11 73,083,907 (GRCm39) missense probably benign 0.07
R2427:Ctns UTSW 11 73,087,512 (GRCm39) missense probably damaging 1.00
R4096:Ctns UTSW 11 73,077,212 (GRCm39) missense probably benign 0.11
R4946:Ctns UTSW 11 73,087,479 (GRCm39) missense probably benign
R6220:Ctns UTSW 11 73,083,954 (GRCm39) missense probably benign 0.00
R6307:Ctns UTSW 11 73,082,559 (GRCm39) missense probably benign 0.26
R6744:Ctns UTSW 11 73,076,111 (GRCm39) missense probably damaging 1.00
R7064:Ctns UTSW 11 73,077,218 (GRCm39) missense probably benign 0.19
R7402:Ctns UTSW 11 73,083,903 (GRCm39) missense possibly damaging 0.51
R7583:Ctns UTSW 11 73,079,296 (GRCm39) missense probably benign 0.44
R8071:Ctns UTSW 11 73,075,760 (GRCm39) missense probably damaging 1.00
R8072:Ctns UTSW 11 73,082,572 (GRCm39) missense probably benign 0.00
R8726:Ctns UTSW 11 73,078,613 (GRCm39) missense probably benign 0.18
R9098:Ctns UTSW 11 73,078,561 (GRCm39) critical splice donor site probably null
R9203:Ctns UTSW 11 73,082,563 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCACCATCCTTTCAAGGCAC -3'
(R):5'- GCCTCCAGGAGAAACCTCTGAAATG -3'

Sequencing Primer
(F):5'- AGGAGAAACTCCTCCTGTTGG -3'
(R):5'- ACCTCTGAAATGGGGGGTG -3'
Posted On 2014-01-05