Incidental Mutation 'R1015:Eps8l1'
ID96129
Institutional Source Beutler Lab
Gene Symbol Eps8l1
Ensembl Gene ENSMUSG00000006154
Gene NameEPS8-like 1
Synonyms4632407K17Rik, 2310051G19Rik, DRC3, EPS8R1
MMRRC Submission 039119-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1015 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4460674-4480487 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4469933 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 118 (D118V)
Ref Sequence ENSEMBL: ENSMUSP00000133206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086372] [ENSMUST00000163137] [ENSMUST00000163804] [ENSMUST00000163893] [ENSMUST00000167298] [ENSMUST00000167810] [ENSMUST00000169820] [ENSMUST00000170635] [ENSMUST00000171445]
Predicted Effect probably damaging
Transcript: ENSMUST00000086372
AA Change: D57V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154
AA Change: D57V

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146199
Predicted Effect probably damaging
Transcript: ENSMUST00000163137
AA Change: D57V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154
AA Change: D57V

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163804
Predicted Effect probably damaging
Transcript: ENSMUST00000163893
AA Change: D57V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154
AA Change: D57V

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167068
Predicted Effect probably benign
Transcript: ENSMUST00000167298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167599
Predicted Effect probably damaging
Transcript: ENSMUST00000167810
AA Change: D57V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126720
Gene: ENSMUSG00000006154
AA Change: D57V

DomainStartEndE-ValueType
Pfam:PTB 35 152 5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169820
AA Change: D57V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131773
Gene: ENSMUSG00000006154
AA Change: D57V

DomainStartEndE-ValueType
Pfam:PTB 35 93 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170423
Predicted Effect probably benign
Transcript: ENSMUST00000170635
SMART Domains Protein: ENSMUSP00000127999
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
PDB:2CY5|A 26 52 3e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000171445
AA Change: D118V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154
AA Change: D118V

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171665
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3d1 A G 10: 80,716,489 V615A probably damaging Het
Atp6v1d A G 12: 78,849,769 V108A possibly damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt6 C A 7: 98,194,595 V53L probably benign Het
C8b A G 4: 104,786,960 K275E probably benign Het
Cage1 T A 13: 38,016,475 N683I possibly damaging Het
Celsr3 T C 9: 108,833,176 V1535A probably benign Het
Cep120 C T 18: 53,703,121 probably null Het
Cep135 T C 5: 76,640,997 probably null Het
Chd9 T A 8: 90,932,578 H55Q probably damaging Het
Dmxl2 G A 9: 54,367,765 T2915I probably benign Het
Galnt2 C T 8: 124,336,617 H359Y probably benign Het
Gm8765 T G 13: 50,701,628 V434G possibly damaging Het
Gm884 T C 11: 103,545,796 H754R probably benign Het
Kdm5d T C Y: 941,687 V1296A possibly damaging Het
Kif27 T A 13: 58,320,215 K849N probably damaging Het
Kif5c T A 2: 49,744,365 D736E probably benign Het
Krt18 T C 15: 102,031,300 I311T probably benign Het
Lamc2 A T 1: 153,166,199 V63D possibly damaging Het
Lmbrd1 T A 1: 24,731,878 C295* probably null Het
Map3k14 T A 11: 103,225,300 Q767H probably damaging Het
Mapkapk5 T C 5: 121,533,362 K203E probably benign Het
Mcc C A 18: 44,724,669 L126F probably benign Het
Mib1 T A 18: 10,726,409 H35Q probably damaging Het
Myo16 A G 8: 10,390,183 N412D probably benign Het
Ndst2 T C 14: 20,730,064 Y36C probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nwd2 T C 5: 63,806,811 I1246T probably damaging Het
Olfr1034 T C 2: 86,047,082 I200T possibly damaging Het
Olfr74 T C 2: 87,974,087 T193A probably benign Het
Patl1 T C 19: 11,920,373 V108A probably benign Het
Pdzd2 T C 15: 12,374,508 E1847G probably damaging Het
Pla2g2f C T 4: 138,754,268 V57I probably benign Het
Prag1 T C 8: 36,146,543 V1083A probably damaging Het
Slc3a2 C T 19: 8,707,955 W227* probably null Het
Snx9 A G 17: 5,920,127 I379M probably benign Het
Tacc2 A G 7: 130,624,065 K846E probably benign Het
Taf4b T A 18: 14,813,098 V326E probably damaging Het
Tnrc6c C T 11: 117,721,922 S462F possibly damaging Het
Trim66 C T 7: 109,455,233 V1257I probably damaging Het
Urb2 T C 8: 124,029,434 Y627H probably damaging Het
Usp53 A G 3: 122,933,759 L1058P probably benign Het
Wdr24 A G 17: 25,828,238 S702G probably benign Het
Other mutations in Eps8l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Eps8l1 APN 7 4478920 utr 3 prime probably benign
IGL01455:Eps8l1 APN 7 4478923 utr 3 prime probably benign
IGL01872:Eps8l1 APN 7 4472296 splice site probably benign
IGL02343:Eps8l1 APN 7 4472124 missense probably benign 0.04
IGL02585:Eps8l1 APN 7 4469213 missense probably damaging 1.00
IGL02596:Eps8l1 APN 7 4470872 missense probably damaging 0.99
IGL02673:Eps8l1 APN 7 4478732 missense probably damaging 1.00
IGL03117:Eps8l1 APN 7 4470887 missense probably damaging 1.00
anamnestic UTSW 7 4470874 missense probably damaging 0.98
souvenir UTSW 7 4477896 missense possibly damaging 0.56
PIT4142001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4151001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4480001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
R0015:Eps8l1 UTSW 7 4477557 splice site probably benign
R0599:Eps8l1 UTSW 7 4477957 missense possibly damaging 0.90
R0686:Eps8l1 UTSW 7 4477450 missense probably benign 0.36
R0827:Eps8l1 UTSW 7 4477389 missense possibly damaging 0.86
R1447:Eps8l1 UTSW 7 4474056 missense probably damaging 1.00
R1490:Eps8l1 UTSW 7 4470889 missense probably damaging 1.00
R1527:Eps8l1 UTSW 7 4471394 missense probably benign
R1553:Eps8l1 UTSW 7 4477449 missense probably damaging 0.98
R1763:Eps8l1 UTSW 7 4471823 missense probably benign 0.43
R1863:Eps8l1 UTSW 7 4465360 utr 5 prime probably benign
R2357:Eps8l1 UTSW 7 4470355 missense probably benign 0.06
R3153:Eps8l1 UTSW 7 4471799 missense probably damaging 1.00
R4082:Eps8l1 UTSW 7 4470798 splice site probably null
R4539:Eps8l1 UTSW 7 4478624 missense probably damaging 1.00
R4684:Eps8l1 UTSW 7 4473945 missense probably damaging 0.99
R4930:Eps8l1 UTSW 7 4460916 missense possibly damaging 0.66
R4931:Eps8l1 UTSW 7 4471241 missense possibly damaging 0.95
R5245:Eps8l1 UTSW 7 4470874 missense probably damaging 0.98
R5247:Eps8l1 UTSW 7 4470402 missense probably damaging 1.00
R5305:Eps8l1 UTSW 7 4477896 missense possibly damaging 0.56
R5420:Eps8l1 UTSW 7 4470161 intron probably null
R5620:Eps8l1 UTSW 7 4460946 missense possibly damaging 0.83
R5705:Eps8l1 UTSW 7 4470035 missense probably benign 0.00
R6063:Eps8l1 UTSW 7 4471297 missense possibly damaging 0.56
R6909:Eps8l1 UTSW 7 4469900 nonsense probably null
R7096:Eps8l1 UTSW 7 4474191 missense probably benign 0.01
R7136:Eps8l1 UTSW 7 4477404 missense probably damaging 1.00
R7144:Eps8l1 UTSW 7 4472185 missense probably damaging 1.00
X0060:Eps8l1 UTSW 7 4470851 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGAACATCCGTCCCTGTTGCC -3'
(R):5'- TTCGGAGCCAAGATTCACCCTCAG -3'

Sequencing Primer
(F):5'- GAAGCCTCCAATCTTGGTTTGAAG -3'
(R):5'- GATTCACCCTCAGATCTCAGC -3'
Posted On2014-01-05