Incidental Mutation 'R1126:Ppp1r9a'
ID96152
Institutional Source Beutler Lab
Gene Symbol Ppp1r9a
Ensembl Gene ENSMUSG00000032827
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 9A
SynonymsA230094E16Rik, Neurabin I, 2810430P21Rik, neurabin-I, NRB, 4930518N04Rik
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location4902917-5165661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4906795 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 450 (E450G)
Ref Sequence ENSEMBL: ENSMUSP00000135360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000168998] [ENSMUST00000175889] [ENSMUST00000175962] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177338] [ENSMUST00000177456]
Predicted Effect probably benign
Transcript: ENSMUST00000035813
AA Change: E450G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827
AA Change: E450G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 5e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1052 6.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164110
Predicted Effect probably benign
Transcript: ENSMUST00000168998
AA Change: E450G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000126643
Gene: ENSMUSG00000032827
AA Change: E450G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175889
AA Change: E450G

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827
AA Change: E450G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1041 1.72e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175962
AA Change: E450G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135360
Gene: ENSMUSG00000032827
AA Change: E450G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDB:3HVQ|D 436 466 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176263
AA Change: E450G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827
AA Change: E450G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
low complexity region 643 649 N/A INTRINSIC
Blast:PDZ 763 800 2e-15 BLAST
low complexity region 806 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176729
AA Change: E130G

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827
AA Change: E130G

DomainStartEndE-ValueType
low complexity region 96 115 N/A INTRINSIC
PDB:3HVQ|D 116 232 4e-79 PDB
SCOP:d1be9a_ 174 232 5e-9 SMART
Blast:PDZ 193 232 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177153
AA Change: E450G

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827
AA Change: E450G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177338
SMART Domains Protein: ENSMUSP00000135634
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177456
AA Change: E450G

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827
AA Change: E450G

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1040 1049 N/A INTRINSIC
low complexity region 1103 1114 N/A INTRINSIC
SAM 1183 1249 6.41e-16 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Ppp1r9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ppp1r9a APN 6 5158195 missense possibly damaging 0.72
IGL00796:Ppp1r9a APN 6 5157014 missense probably benign 0.37
IGL00906:Ppp1r9a APN 6 5157023 missense possibly damaging 0.62
IGL01662:Ppp1r9a APN 6 5115322 missense probably damaging 1.00
IGL01695:Ppp1r9a APN 6 5064003 missense probably damaging 1.00
IGL01807:Ppp1r9a APN 6 5158248 nonsense probably null
IGL02126:Ppp1r9a APN 6 5156229 missense probably damaging 1.00
IGL02423:Ppp1r9a APN 6 4906537 missense probably benign 0.25
IGL03343:Ppp1r9a APN 6 5046015 missense probably damaging 1.00
IGL03365:Ppp1r9a APN 6 5110993 splice site probably benign
R0545:Ppp1r9a UTSW 6 5115357 missense probably benign 0.45
R1137:Ppp1r9a UTSW 6 5159697 missense possibly damaging 0.46
R1443:Ppp1r9a UTSW 6 5057557 missense probably damaging 1.00
R1484:Ppp1r9a UTSW 6 5113712 nonsense probably null
R1545:Ppp1r9a UTSW 6 5156242 critical splice donor site probably null
R1627:Ppp1r9a UTSW 6 4906168 missense possibly damaging 0.50
R1672:Ppp1r9a UTSW 6 5143491 critical splice donor site probably null
R1826:Ppp1r9a UTSW 6 5111060 splice site probably benign
R1834:Ppp1r9a UTSW 6 5113710 missense probably damaging 0.98
R1874:Ppp1r9a UTSW 6 4906348 missense possibly damaging 0.87
R2224:Ppp1r9a UTSW 6 5154074 missense probably benign
R2227:Ppp1r9a UTSW 6 5154074 missense probably benign
R2898:Ppp1r9a UTSW 6 4906558 missense probably benign 0.01
R3606:Ppp1r9a UTSW 6 5113674 missense possibly damaging 0.90
R3732:Ppp1r9a UTSW 6 4906259 unclassified probably benign
R3927:Ppp1r9a UTSW 6 5057531 missense probably damaging 1.00
R4631:Ppp1r9a UTSW 6 4906537 missense possibly damaging 0.62
R4682:Ppp1r9a UTSW 6 4905477 missense possibly damaging 0.48
R4766:Ppp1r9a UTSW 6 5157016 missense probably benign 0.11
R5197:Ppp1r9a UTSW 6 5156177 missense probably damaging 1.00
R5217:Ppp1r9a UTSW 6 5115367 missense probably damaging 1.00
R5493:Ppp1r9a UTSW 6 5159702 missense probably damaging 0.99
R5790:Ppp1r9a UTSW 6 5134363 intron probably benign
R5828:Ppp1r9a UTSW 6 5158200 missense probably damaging 1.00
R5896:Ppp1r9a UTSW 6 5159648 missense probably damaging 1.00
R5930:Ppp1r9a UTSW 6 5157002 critical splice acceptor site probably null
R5990:Ppp1r9a UTSW 6 5134660 missense probably benign 0.05
R6017:Ppp1r9a UTSW 6 4906363 missense probably benign 0.18
R6122:Ppp1r9a UTSW 6 4905509 missense probably damaging 1.00
R6164:Ppp1r9a UTSW 6 5110715 intron probably benign
R6175:Ppp1r9a UTSW 6 4905639 nonsense probably null
R6188:Ppp1r9a UTSW 6 5158113 nonsense probably null
R6233:Ppp1r9a UTSW 6 5077610 missense probably damaging 1.00
R6321:Ppp1r9a UTSW 6 5115151 missense probably damaging 1.00
R6449:Ppp1r9a UTSW 6 5057458 missense probably benign 0.44
R6454:Ppp1r9a UTSW 6 4905827 missense probably damaging 1.00
R6527:Ppp1r9a UTSW 6 5045949 missense probably damaging 1.00
R7053:Ppp1r9a UTSW 6 4905670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTGACAGGTGGTGACCTAAC -3'
(R):5'- CCACTTACGCTGAAGGGATGACTC -3'

Sequencing Primer
(F):5'- ACAGTTTTGAGAGTTCCCACG -3'
(R):5'- tgtgtgtgtgtgtgtTCCAC -3'
Posted On2014-01-05