Incidental Mutation 'R1015:AU022751'
List |< first << previous [record 38 of 686] next >> last >|
ID96244
Institutional Source Beutler Lab
Gene Symbol AU022751
Ensembl Gene ENSMUSG00000073294
Gene Nameexpressed sequence AU022751
Synonyms
MMRRC Submission 039119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.026) question?
Stock #R1015 (G1)
Quality Score217
Status Not validated
ChromosomeX
Chromosomal Location6081219-6083419 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GTCATCATCATCATC to GTCATCATCATCATCATC at 6082591 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101698] [ENSMUST00000117544]
Predicted Effect probably benign
Transcript: ENSMUST00000101698
SMART Domains Protein: ENSMUSP00000099222
Gene: ENSMUSG00000073294

DomainStartEndE-ValueType
low complexity region 19 42 N/A INTRINSIC
low complexity region 113 134 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
low complexity region 252 292 N/A INTRINSIC
low complexity region 314 344 N/A INTRINSIC
low complexity region 388 407 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117544
SMART Domains Protein: ENSMUSP00000114041
Gene: ENSMUSG00000073294

DomainStartEndE-ValueType
low complexity region 19 42 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 321 337 N/A INTRINSIC
low complexity region 347 363 N/A INTRINSIC
low complexity region 373 413 N/A INTRINSIC
low complexity region 435 465 N/A INTRINSIC
low complexity region 509 528 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181123
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3d1 A G 10: 80,716,489 V615A probably damaging Het
Atp6v1d A G 12: 78,849,769 V108A possibly damaging Het
B3gnt6 C A 7: 98,194,595 V53L probably benign Het
C8b A G 4: 104,786,960 K275E probably benign Het
Cage1 T A 13: 38,016,475 N683I possibly damaging Het
Celsr3 T C 9: 108,833,176 V1535A probably benign Het
Cep120 C T 18: 53,703,121 probably null Het
Cep135 T C 5: 76,640,997 probably null Het
Chd9 T A 8: 90,932,578 H55Q probably damaging Het
Dmxl2 G A 9: 54,367,765 T2915I probably benign Het
Eps8l1 A T 7: 4,469,933 D118V probably damaging Het
Galnt2 C T 8: 124,336,617 H359Y probably benign Het
Gm8765 T G 13: 50,701,628 V434G possibly damaging Het
Gm884 T C 11: 103,545,796 H754R probably benign Het
Kdm5d T C Y: 941,687 V1296A possibly damaging Het
Kif27 T A 13: 58,320,215 K849N probably damaging Het
Kif5c T A 2: 49,744,365 D736E probably benign Het
Krt18 T C 15: 102,031,300 I311T probably benign Het
Lamc2 A T 1: 153,166,199 V63D possibly damaging Het
Lmbrd1 T A 1: 24,731,878 C295* probably null Het
Map3k14 T A 11: 103,225,300 Q767H probably damaging Het
Mapkapk5 T C 5: 121,533,362 K203E probably benign Het
Mcc C A 18: 44,724,669 L126F probably benign Het
Mib1 T A 18: 10,726,409 H35Q probably damaging Het
Myo16 A G 8: 10,390,183 N412D probably benign Het
Ndst2 T C 14: 20,730,064 Y36C probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nwd2 T C 5: 63,806,811 I1246T probably damaging Het
Olfr1034 T C 2: 86,047,082 I200T possibly damaging Het
Olfr74 T C 2: 87,974,087 T193A probably benign Het
Patl1 T C 19: 11,920,373 V108A probably benign Het
Pdzd2 T C 15: 12,374,508 E1847G probably damaging Het
Pla2g2f C T 4: 138,754,268 V57I probably benign Het
Prag1 T C 8: 36,146,543 V1083A probably damaging Het
Slc3a2 C T 19: 8,707,955 W227* probably null Het
Snx9 A G 17: 5,920,127 I379M probably benign Het
Tacc2 A G 7: 130,624,065 K846E probably benign Het
Taf4b T A 18: 14,813,098 V326E probably damaging Het
Tnrc6c C T 11: 117,721,922 S462F possibly damaging Het
Trim66 C T 7: 109,455,233 V1257I probably damaging Het
Urb2 T C 8: 124,029,434 Y627H probably damaging Het
Usp53 A G 3: 122,933,759 L1058P probably benign Het
Wdr24 A G 17: 25,828,238 S702G probably benign Het
Other mutations in AU022751
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1102:AU022751 UTSW X 6082591 small insertion probably benign
R1513:AU022751 UTSW X 6082591 small insertion probably benign
R1885:AU022751 UTSW X 6082591 small insertion probably benign
R1886:AU022751 UTSW X 6082591 small insertion probably benign
R1887:AU022751 UTSW X 6082591 small insertion probably benign
R1931:AU022751 UTSW X 6082763 missense probably benign 0.07
R1996:AU022751 UTSW X 6082591 small insertion probably benign
R2255:AU022751 UTSW X 6082700 missense probably benign 0.03
R3857:AU022751 UTSW X 6082656 missense possibly damaging 0.83
R3859:AU022751 UTSW X 6082656 missense possibly damaging 0.83
X0018:AU022751 UTSW X 6081975 missense unknown
Predicted Primers PCR Primer
(F):5'- CGAGGACGTAAATTCCAGCCTGTG -3'
(R):5'- TGGACATGCAAGGCCCATGATGAG -3'

Sequencing Primer
(F):5'- TCCTACGACCGAAAGGTACA -3'
(R):5'- AGCCAGAGTCTTCTCTGAGC -3'
Posted On2014-01-05