Incidental Mutation 'R1016:Hpf1'
ID96324
Institutional Source Beutler Lab
Gene Symbol Hpf1
Ensembl Gene ENSMUSG00000038005
Gene Namehistone PARylation factor 1
Synonyms2700029M09Rik
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1016 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location60890418-60908671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60895644 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 131 (Y131C)
Ref Sequence ENSEMBL: ENSMUSP00000047235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037190] [ENSMUST00000136098] [ENSMUST00000146863] [ENSMUST00000149267]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037190
AA Change: Y131C

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047235
Gene: ENSMUSG00000038005
AA Change: Y131C

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:DUF2228 77 328 7e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134886
Predicted Effect probably benign
Transcript: ENSMUST00000136098
SMART Domains Protein: ENSMUSP00000119448
Gene: ENSMUSG00000038005

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146863
Predicted Effect probably benign
Transcript: ENSMUST00000149267
SMART Domains Protein: ENSMUSP00000118277
Gene: ENSMUSG00000038005

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fancl G T 11: 26,387,195 probably benign Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Hpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Hpf1 APN 8 60896802 missense probably benign
IGL00977:Hpf1 APN 8 60905719 missense probably benign 0.10
IGL01564:Hpf1 APN 8 60890479 utr 5 prime probably benign
IGL01688:Hpf1 APN 8 60896796 missense probably benign
IGL02352:Hpf1 APN 8 60896802 missense probably benign
IGL02359:Hpf1 APN 8 60896802 missense probably benign
R0571:Hpf1 UTSW 8 60900113 missense probably benign 0.02
R1522:Hpf1 UTSW 8 60896749 missense probably damaging 0.96
R1806:Hpf1 UTSW 8 60900120 missense probably benign 0.01
R4652:Hpf1 UTSW 8 60893730 missense possibly damaging 0.48
R4814:Hpf1 UTSW 8 60893807 missense probably damaging 1.00
R5268:Hpf1 UTSW 8 60893734 missense possibly damaging 0.92
R5645:Hpf1 UTSW 8 60896800 missense possibly damaging 0.85
R6221:Hpf1 UTSW 8 60893774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGATGCGCTTGCCACAAGCCTG -3'
(R):5'- TTGGCTGCAAAGTTCTTCTGAACCC -3'

Sequencing Primer
(F):5'- CCTGGGTCTTCGGTTAGTG -3'
(R):5'- ACCcaaaacaaaacaaaacaaaaac -3'
Posted On2014-01-05