Incidental Mutation 'R1016:Crtc1'
ID96326
Institutional Source Beutler Lab
Gene Symbol Crtc1
Ensembl Gene ENSMUSG00000003575
Gene NameCREB regulated transcription coactivator 1
SynonymsMect1, TORC1
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R1016 (G1)
Quality Score200
Status Not validated
Chromosome8
Chromosomal Location70382355-70439579 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 70392119 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 351 (Y351*)
Ref Sequence ENSEMBL: ENSMUSP00000075916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076615]
Predicted Effect probably null
Transcript: ENSMUST00000076615
AA Change: Y351*
SMART Domains Protein: ENSMUSP00000075916
Gene: ENSMUSG00000003575
AA Change: Y351*

DomainStartEndE-ValueType
Pfam:TORC_N 6 66 1.1e-26 PFAM
Pfam:TORC_M 148 289 4.8e-64 PFAM
low complexity region 359 394 N/A INTRINSIC
Pfam:TORC_C 555 630 9.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142769
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an inactivating mutation in this gene are hyperphagic, obese and infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fancl G T 11: 26,387,195 probably benign Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Crtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Crtc1 APN 8 70439522 missense probably benign 0.01
IGL01361:Crtc1 APN 8 70387603 missense probably damaging 1.00
IGL02883:Crtc1 APN 8 70406125 missense probably benign 0.28
R0049:Crtc1 UTSW 8 70391859 critical splice donor site probably null
R0196:Crtc1 UTSW 8 70386221 missense probably damaging 1.00
R0514:Crtc1 UTSW 8 70402429 critical splice donor site probably null
R0588:Crtc1 UTSW 8 70439549 missense probably damaging 0.99
R0744:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0833:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0836:Crtc1 UTSW 8 70393013 missense probably benign 0.00
R0905:Crtc1 UTSW 8 70391255 missense probably damaging 1.00
R1300:Crtc1 UTSW 8 70387539 critical splice donor site probably null
R1533:Crtc1 UTSW 8 70398299 missense probably damaging 1.00
R1843:Crtc1 UTSW 8 70388152 missense probably benign 0.00
R2393:Crtc1 UTSW 8 70388158 missense probably benign
R4867:Crtc1 UTSW 8 70402514 missense probably damaging 1.00
R5339:Crtc1 UTSW 8 70397733 splice site probably benign
R6062:Crtc1 UTSW 8 70406189 missense probably damaging 1.00
R6342:Crtc1 UTSW 8 70439557 start codon destroyed probably null 0.95
R6912:Crtc1 UTSW 8 70398311 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCCTGTGTAAAGCTGATGGC -3'
(R):5'- TCCTGTGTGAGATCCACCCTCAAC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- ACAAGTTGGGCTCCCTTGC -3'
Posted On2014-01-05