Incidental Mutation 'R1016:Tet1'
ID96334
Institutional Source Beutler Lab
Gene Symbol Tet1
Ensembl Gene ENSMUSG00000047146
Gene Nametet methylcytosine dioxygenase 1
SynonymsBB001228, 2510010B09Rik, D10Ertd17e, Cxxc6
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1016 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62804570-62908996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62879950 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 22 (D22G)
Ref Sequence ENSEMBL: ENSMUSP00000133279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050826] [ENSMUST00000174189] [ENSMUST00000218438] [ENSMUST00000218782] [ENSMUST00000227494] [ENSMUST00000228901]
Predicted Effect probably benign
Transcript: ENSMUST00000050826
AA Change: D22G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059527
Gene: ENSMUSG00000047146
AA Change: D22G

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.5e-11 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1931 1e-171 SMART
low complexity region 1944 1956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174189
AA Change: D22G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133279
Gene: ENSMUSG00000047146
AA Change: D22G

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.7e-10 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1963 7.36e-170 SMART
low complexity region 1976 1988 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000218438
AA Change: D22G
Predicted Effect unknown
Transcript: ENSMUST00000218782
AA Change: D22G
Predicted Effect unknown
Transcript: ENSMUST00000227494
AA Change: D22G
Predicted Effect unknown
Transcript: ENSMUST00000228901
AA Change: D22G
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is an epigenetic mechanism that is important for controlling gene expression. The protein encoded by this gene is a demethylase that belongs to the TET (ten-eleven translocation) family. Members of the TET protein family play a role in the DNA methylation process and gene activation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive lethality, abnormal forebrain development, abnormal female reproductive organs and decreased litter size. Mice homozygous for a different knock-out allele exhibit impaired adult neurogenesis, impaired spatial learning and impaired short-term memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fancl G T 11: 26,387,195 probably benign Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Tet1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Tet1 APN 10 62814497 missense probably damaging 1.00
IGL01079:Tet1 APN 10 62879473 missense probably damaging 0.99
IGL01109:Tet1 APN 10 62879774 missense probably benign
IGL01634:Tet1 APN 10 62878588 missense possibly damaging 0.94
IGL02003:Tet1 APN 10 62816400 missense possibly damaging 0.92
IGL02081:Tet1 APN 10 62813818 missense probably damaging 1.00
IGL02100:Tet1 APN 10 62812728 missense possibly damaging 0.92
IGL02228:Tet1 APN 10 62813734 missense probably damaging 0.99
IGL02524:Tet1 APN 10 62878646 missense probably damaging 1.00
IGL02539:Tet1 APN 10 62813019 missense possibly damaging 0.60
IGL02608:Tet1 APN 10 62879609 missense possibly damaging 0.82
IGL02608:Tet1 APN 10 62839087 missense probably damaging 1.00
IGL02702:Tet1 APN 10 62879752 missense possibly damaging 0.83
K7371:Tet1 UTSW 10 62879176 missense probably benign
R0166:Tet1 UTSW 10 62840279 missense probably benign 0.05
R0371:Tet1 UTSW 10 62878399 missense probably damaging 0.97
R0373:Tet1 UTSW 10 62878209 nonsense probably null
R0391:Tet1 UTSW 10 62814546 unclassified probably null
R0445:Tet1 UTSW 10 62879941 missense probably benign 0.08
R1344:Tet1 UTSW 10 62814521 missense probably damaging 1.00
R1546:Tet1 UTSW 10 62812910 missense probably damaging 1.00
R1651:Tet1 UTSW 10 62879674 missense probably damaging 1.00
R1725:Tet1 UTSW 10 62814477 missense probably damaging 1.00
R1752:Tet1 UTSW 10 62812989 missense probably damaging 0.99
R1834:Tet1 UTSW 10 62813665 missense probably damaging 0.99
R1964:Tet1 UTSW 10 62812947 missense possibly damaging 0.86
R2239:Tet1 UTSW 10 62879734 missense probably benign 0.01
R2962:Tet1 UTSW 10 62814544 nonsense probably null
R3084:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3086:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3972:Tet1 UTSW 10 62813726 missense probably damaging 1.00
R4622:Tet1 UTSW 10 62819474 missense possibly damaging 0.92
R4674:Tet1 UTSW 10 62838848 missense probably damaging 0.97
R4687:Tet1 UTSW 10 62838791 missense probably benign 0.04
R4718:Tet1 UTSW 10 62813812 missense probably damaging 0.96
R4801:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4802:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4903:Tet1 UTSW 10 62822658 missense probably damaging 1.00
R5153:Tet1 UTSW 10 62878578 missense possibly damaging 0.85
R5193:Tet1 UTSW 10 62838247 missense probably benign 0.22
R5225:Tet1 UTSW 10 62838671 missense probably damaging 1.00
R5437:Tet1 UTSW 10 62814451 missense probably benign 0.01
R5465:Tet1 UTSW 10 62839777 missense probably benign
R5535:Tet1 UTSW 10 62832907 missense probably damaging 1.00
R5586:Tet1 UTSW 10 62878294 missense probably damaging 1.00
R5763:Tet1 UTSW 10 62840068 missense probably damaging 1.00
R5788:Tet1 UTSW 10 62839958 missense possibly damaging 0.70
R5818:Tet1 UTSW 10 62816408 missense possibly damaging 0.71
R5860:Tet1 UTSW 10 62812620 unclassified probably null
R5975:Tet1 UTSW 10 62879773 missense probably benign 0.37
R6041:Tet1 UTSW 10 62813373 missense probably damaging 0.98
R6092:Tet1 UTSW 10 62813715 missense probably benign 0.10
R6132:Tet1 UTSW 10 62813300 missense probably damaging 0.99
R6157:Tet1 UTSW 10 62839970 missense probably damaging 0.98
R6520:Tet1 UTSW 10 62880013 start codon destroyed probably null 0.53
R7210:Tet1 UTSW 10 62814501 missense probably null 0.95
R7223:Tet1 UTSW 10 62813671 missense possibly damaging 0.95
R7255:Tet1 UTSW 10 62822636 missense probably benign 0.15
R7323:Tet1 UTSW 10 62880039 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCGCCAGCTAAGAGAGGTTCTTCG -3'
(R):5'- AGCTTGGCAACACCTCCAGATTC -3'

Sequencing Primer
(F):5'- GAGCCATTGTAAACCCGTTG -3'
(R):5'- TCCAGATTCTCCTCAAAAGGAAG -3'
Posted On2014-01-05