Incidental Mutation 'R1016:Dmrt2'
ID96366
Institutional Source Beutler Lab
Gene Symbol Dmrt2
Ensembl Gene ENSMUSG00000048138
Gene Namedoublesex and mab-3 related transcription factor 2
SynonymsTerra
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1016 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location25672420-25679010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25675574 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 183 (K183N)
Ref Sequence ENSEMBL: ENSMUSP00000059654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053068]
Predicted Effect probably damaging
Transcript: ENSMUST00000053068
AA Change: K183N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059654
Gene: ENSMUSG00000048138
AA Change: K183N

DomainStartEndE-ValueType
low complexity region 38 74 N/A INTRINSIC
low complexity region 78 115 N/A INTRINSIC
DM 119 172 5.2e-28 SMART
low complexity region 224 229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188711
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DMRT gene family, sharing a DM DNA-binding domain with Drosophila 'doublesex' (dsx) and C. elegans mab3, genes involved in sex determination in these organisms. Also, this gene is located in a region of the human genome (chromosome 9p24.3) associated with gonadal dysgenesis and XY sex reversal. Hence this gene is one of the candidates for sex-determining gene(s) on chr 9. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display perinatal lethality due to breathing difficulties, multiple axial skeletal defects including kinked tails and rib and vertebral malformations, and abnormal somite organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Fancl G T 11: 26,387,195 probably benign Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Dmrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmrt2 APN 19 25678134 missense probably damaging 1.00
IGL02269:Dmrt2 APN 19 25678459 missense probably benign 0.01
IGL02740:Dmrt2 APN 19 25678473 missense possibly damaging 0.84
R0141:Dmrt2 UTSW 19 25678291 missense possibly damaging 0.52
R0294:Dmrt2 UTSW 19 25678071 missense probably damaging 1.00
R0352:Dmrt2 UTSW 19 25678662 missense probably damaging 1.00
R0514:Dmrt2 UTSW 19 25675655 critical splice donor site probably null
R1104:Dmrt2 UTSW 19 25678616 missense probably benign 0.01
R1164:Dmrt2 UTSW 19 25677993 missense possibly damaging 0.89
R1467:Dmrt2 UTSW 19 25673606 missense possibly damaging 0.72
R1467:Dmrt2 UTSW 19 25673606 missense possibly damaging 0.72
R3107:Dmrt2 UTSW 19 25677691 missense probably benign 0.01
R3109:Dmrt2 UTSW 19 25677691 missense probably benign 0.01
R4029:Dmrt2 UTSW 19 25678134 missense probably damaging 0.99
R4841:Dmrt2 UTSW 19 25677667 missense probably damaging 1.00
R5317:Dmrt2 UTSW 19 25673480 missense probably benign 0.00
R6335:Dmrt2 UTSW 19 25673571 missense possibly damaging 0.73
R6554:Dmrt2 UTSW 19 25677948 missense probably damaging 1.00
R6752:Dmrt2 UTSW 19 25678342 missense probably damaging 0.96
X0058:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
X0060:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
X0063:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
Z1088:Dmrt2 UTSW 19 25678642 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTGAGATTAAGAGGCACTCCCG -3'
(R):5'- GGGTGTTCCAGGATCACTTGACAG -3'

Sequencing Primer
(F):5'- GAGGCACTCCCGTTAATTATTTTG -3'
(R):5'- TTTCACCAGGTGTAACAGCG -3'
Posted On2014-01-05