Incidental Mutation 'R1128:Spocd1'
ID96385
Institutional Source Beutler Lab
Gene Symbol Spocd1
Ensembl Gene ENSMUSG00000028784
Gene NameSPOC domain containing 1
SynonymsOTTMUSG00000009522
MMRRC Submission 039201-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1128 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129929249-129957115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129956806 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 875 (V875A)
Ref Sequence ENSEMBL: ENSMUSP00000081284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084263] [ENSMUST00000128007]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084263
AA Change: V875A

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081284
Gene: ENSMUSG00000028784
AA Change: V875A

DomainStartEndE-ValueType
Pfam:TFIIS_M 1 105 1.7e-24 PFAM
Blast:PAC 123 163 4e-7 BLAST
Pfam:SPOC 247 350 1e-22 PFAM
low complexity region 454 467 N/A INTRINSIC
low complexity region 559 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128007
SMART Domains Protein: ENSMUSP00000118383
Gene: ENSMUSG00000028784

DomainStartEndE-ValueType
Pfam:TFIIS_M 5 113 3.6e-28 PFAM
Blast:PAC 129 157 6e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147634
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the TFIIS family of transcription factors. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 G A 1: 87,127,871 G547R unknown Het
Amhr2 A T 15: 102,452,821 Q402L probably benign Het
Brip1 A T 11: 86,064,937 L917M possibly damaging Het
Dennd5a G A 7: 109,921,334 R415* probably null Het
Eif2ak1 G T 5: 143,899,176 probably null Het
Golga4 G A 9: 118,548,784 A458T probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Ift88 C T 14: 57,517,019 R762* probably null Het
Kansl2 A T 15: 98,533,685 C28* probably null Het
Lct T C 1: 128,301,309 R816G probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Obscn T C 11: 59,028,943 N6809S probably null Het
Pak6 A G 2: 118,696,509 T662A probably benign Het
Pglyrp3 T C 3: 92,028,172 F243S probably benign Het
Rab44 T C 17: 29,140,461 V541A possibly damaging Het
Slc39a6 G T 18: 24,585,292 H569Q probably damaging Het
Slc4a7 T C 14: 14,733,832 S87P probably damaging Het
Tspan17 A G 13: 54,795,171 D146G probably damaging Het
Other mutations in Spocd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Spocd1 APN 4 129953587 missense probably damaging 0.99
IGL02332:Spocd1 APN 4 129949092 missense probably damaging 1.00
IGL02796:Spocd1 APN 4 129947755 intron probably benign
R0005:Spocd1 UTSW 4 129956778 missense possibly damaging 0.73
R0499:Spocd1 UTSW 4 129955470 missense possibly damaging 0.56
R0939:Spocd1 UTSW 4 129948870 missense possibly damaging 0.93
R5747:Spocd1 UTSW 4 129954945 missense probably damaging 1.00
R5774:Spocd1 UTSW 4 129951786 missense probably benign 0.04
R5872:Spocd1 UTSW 4 129956461 missense probably damaging 0.99
R5887:Spocd1 UTSW 4 129948959 missense probably damaging 1.00
R6185:Spocd1 UTSW 4 129956449 missense probably benign 0.02
R6198:Spocd1 UTSW 4 129955415 missense probably damaging 1.00
R6245:Spocd1 UTSW 4 129957108 unclassified probably null
R6412:Spocd1 UTSW 4 129953572 missense probably benign 0.44
R6804:Spocd1 UTSW 4 129953630 nonsense probably null
R6884:Spocd1 UTSW 4 129955404 unclassified probably benign
R6898:Spocd1 UTSW 4 129956512 unclassified probably benign
R7090:Spocd1 UTSW 4 129953898 missense
R7548:Spocd1 UTSW 4 129929809 missense not run
R7570:Spocd1 UTSW 4 129930164 missense not run
Predicted Primers PCR Primer
(F):5'- CAAAGACCGTGTCCTTCAGCAAAAG -3'
(R):5'- TCAACACTCATGTTCTGGTGGCTC -3'

Sequencing Primer
(F):5'- TCATCTCCCCTTGAAGAGGAC -3'
(R):5'- CTAAAGGGTCTGACCCCTCTG -3'
Posted On2014-01-05