Incidental Mutation 'R1017:Gon4l'
ID96405
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
MMRRC Submission 039121-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R1017 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88858496 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 409 (M409K)
Ref Sequence ENSEMBL: ENSMUSP00000088461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]
Predicted Effect probably benign
Transcript: ENSMUST00000081695
AA Change: M408K

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: M408K

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082804
Predicted Effect probably benign
Transcript: ENSMUST00000090942
AA Change: M409K

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: M409K

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107498
AA Change: M408K

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: M408K

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198251
Predicted Effect unknown
Transcript: ENSMUST00000212694
AA Change: M116K
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp C T 6: 125,061,260 probably benign Het
Ahnak A T 19: 9,010,543 I3064F probably damaging Het
Arhgef10l C A 4: 140,515,306 R884L probably damaging Het
Baiap2l2 A G 15: 79,261,243 F317L probably benign Het
Brinp2 A T 1: 158,249,451 I358N probably damaging Het
Ccin A G 4: 43,985,222 D543G probably benign Het
Cdh23 T A 10: 60,331,793 D1806V probably damaging Het
Cdh6 C T 15: 13,051,476 R357Q probably benign Het
Cpa3 T C 3: 20,239,633 M64V possibly damaging Het
Ctnnb1 T A 9: 120,950,728 F74I probably damaging Het
Cyp7a1 A T 4: 6,272,307 I302N probably damaging Het
Dnase1l2 C T 17: 24,442,472 A56T probably benign Het
Dscam T A 16: 96,833,433 D190V probably damaging Het
Fer1l4 T C 2: 156,049,478 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm10306 A G 4: 94,556,720 probably benign Het
Gsx2 T C 5: 75,077,262 S292P probably damaging Het
Hira T A 16: 18,899,347 probably null Het
Hoxa3 G T 6: 52,172,406 probably null Het
Irak3 T C 10: 120,142,884 E554G possibly damaging Het
Itgb3bp A G 4: 99,769,487 probably benign Het
Kifc3 C T 8: 95,105,785 D379N probably damaging Het
Lama5 A G 2: 180,195,420 V1032A probably damaging Het
Lmln T G 16: 33,088,176 I324R probably benign Het
Ltbp4 A G 7: 27,306,076 S1547P possibly damaging Het
Mdga1 T A 17: 29,850,548 T175S probably damaging Het
Mrps6 T A 16: 92,058,458 L8* probably null Het
Mtmr11 A C 3: 96,164,477 T203P probably damaging Het
Nat8f7 T C 6: 85,707,570 D96G probably damaging Het
Obscn T C 11: 58,998,353 E7531G unknown Het
Olfr1061 A T 2: 86,413,511 D180E probably damaging Het
Olfr1065 A T 2: 86,445,428 L185I probably benign Het
Olfr267 A T 4: 58,785,115 S202R probably damaging Het
Osbpl6 A G 2: 76,549,719 Y69C probably damaging Het
Polrmt C T 10: 79,743,509 W136* probably null Het
Raver1 T C 9: 21,079,590 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rsl1d1 T C 16: 11,203,252 K2E probably benign Het
Sik3 C T 9: 46,195,809 T417I probably benign Het
Spdl1 T C 11: 34,819,290 K388R possibly damaging Het
Tulp1 T C 17: 28,364,303 R88G probably damaging Het
Vldlr A C 19: 27,241,333 Y528S probably damaging Het
Zdhhc14 T A 17: 5,493,649 L68H probably damaging Het
Zfp605 C T 5: 110,127,994 T326I probably benign Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0020:Gon4l UTSW 3 88858937 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4569:Gon4l UTSW 3 88910090 intron probably benign
R4650:Gon4l UTSW 3 88863552 missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4901:Gon4l UTSW 3 88908151 missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5059:Gon4l UTSW 3 88900012 missense probably benign 0.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5283:Gon4l UTSW 3 88887590 missense probably damaging 1.00
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88899971 missense probably damaging 1.00
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6217:Gon4l UTSW 3 88892661 missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 intron probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
R7315:Gon4l UTSW 3 88895179 missense probably benign 0.00
R7355:Gon4l UTSW 3 88863520 missense probably damaging 1.00
R7426:Gon4l UTSW 3 88907522 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATTTCGTGCTCTGGACGGAGG -3'
(R):5'- TCCATGCAGACAGGACTGGAGG -3'

Sequencing Primer
(F):5'- GTTGGGGCACACACATGAG -3'
(R):5'- TCAGCACTGATGTGCCTGAG -3'
Posted On2014-01-05