Mutagenetix > Incidental Mutation

Incidental Mutation 'R1017:Ctnnb1'

96457

Institutional Source

Beutler Lab

Gene Symbol

Ctnnb1

Ensembl Gene

ENSMUSG00000006932

Gene Name

catenin beta 1

Synonyms

Catnb, beta catenin, beta-catenin, catenin (cadherin associated protein), beta 1

MMRRC Submission

039121-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1017 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120762466-120789573 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 120779794 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 74 (F74I)

Ref Sequence

ENSEMBL: ENSMUSP00000116365 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007130] [ENSMUST00000130466] [ENSMUST00000130845] [ENSMUST00000145093] [ENSMUST00000154356] [ENSMUST00000178812] [ENSMUST00000163844]

AlphaFold

Q02248

Predicted Effect

possibly damaging
Transcript: ENSMUST00000007130
AA Change: F74I

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000007130
Gene: ENSMUSG00000006932
AA Change: F74I

Domain	Start	End	E-Value	Type
ARM	141	180	1.92e1	SMART
ARM	181	223	6.29e-2	SMART
ARM	224	264	1.23e-4	SMART
ARM	265	306	7.34e-3	SMART
ARM	308	349	2.48e0	SMART
ARM	350	390	1.48e-7	SMART
ARM	392	429	3.18e1	SMART
ARM	430	473	1.54e-5	SMART
ARM	478	519	7.34e-3	SMART
ARM	520	582	3.34e-6	SMART
ARM	583	623	2.82e-4	SMART
ARM	624	664	1.78e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126633

Predicted Effect

probably benign
Transcript: ENSMUST00000130466

Predicted Effect

probably damaging
Transcript: ENSMUST00000130845
AA Change: F74I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116365
Gene: ENSMUSG00000006932
AA Change: F74I

Domain	Start	End	E-Value	Type
PDB:2Z6G\|A	1	80	2e-43	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145093
AA Change: F74I

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120132
Gene: ENSMUSG00000006932
AA Change: F74I

Domain	Start	End	E-Value	Type
PDB:2Z6G\|A	1	174	1e-113	PDB
SCOP:d1gw5a_	90	172	5e-8	SMART
Blast:ARM	141	174	4e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000154356
AA Change: F74I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000125763
Gene: ENSMUSG00000006932
AA Change: F74I

Domain	Start	End	E-Value	Type
ARM	141	180	1.92e1	SMART
ARM	181	223	6.29e-2	SMART
ARM	224	264	1.23e-4	SMART
ARM	265	306	7.34e-3	SMART
ARM	308	349	2.48e0	SMART
ARM	350	390	1.48e-7	SMART
ARM	392	429	3.18e1	SMART
ARM	430	473	1.54e-5	SMART
ARM	478	519	7.34e-3	SMART
ARM	520	562	3e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154687

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178812
AA Change: F74I

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000136294
Gene: ENSMUSG00000006932
AA Change: F74I

Domain	Start	End	E-Value	Type
ARM	141	180	1.92e1	SMART
ARM	181	223	6.29e-2	SMART
ARM	224	264	1.23e-4	SMART
ARM	265	306	7.34e-3	SMART
ARM	308	349	2.48e0	SMART
ARM	350	390	1.48e-7	SMART
ARM	392	429	3.18e1	SMART
ARM	430	473	1.54e-5	SMART
ARM	478	519	7.34e-3	SMART
ARM	520	582	3.34e-6	SMART
ARM	583	623	2.82e-4	SMART
ARM	624	664	1.78e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163844

SMART Domains

Protein: ENSMUSP00000126905
Gene: ENSMUSG00000006932

Domain	Start	End	E-Value	Type
PDB:2Z6G\|A	1	72	2e-37	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198187

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156911

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213408

Predicted Effect

probably benign
Transcript: ENSMUST00000170729

SMART Domains

Protein: ENSMUSP00000130471
Gene: ENSMUSG00000006932

Domain	Start	End	E-Value	Type
Blast:ARM	2	35	4e-15	BLAST
PDB:3SLA\|E	2	87	1e-57	PDB
SCOP:d1jdha_	2	89	2e-12	SMART
Blast:ARM	36	78	2e-23	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000169931

SMART Domains

Protein: ENSMUSP00000128858
Gene: ENSMUSG00000006932

Domain	Start	End	E-Value	Type
ARM	2	36	3.8e1	SMART
ARM	41	82	7.34e-3	SMART
ARM	83	144	1.92e-6	SMART

Meta Mutation Damage Score

0.0859

Coding Region Coverage

1x: 99.7%
3x: 98.8%
10x: 96.8%
20x: 93.4%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: This gene encodes not only an important cytoplasmic component of the classical cadherin adhesion complex that forms the adherens junction in epithelia and mediates cell-cell adhesion in many other tissues but also a key signaling molecule in the canonical Wnt signaling pathway that controls cell growth and differentiation during both normal development and tumorigenesis. The gene product contains a central armadillo-repeat containing domain through which it binds the cytoplasmic tail of classical cadherins; meanwhile, it also binds alpha-catenin, which further links the cadherin complex to the actin cytoskeleton either directly or indirectly. Beta-catenin is therefore necessary for the adhesive function of classical cadherins. Another key function of this protein is to mediate the canonical Wnt signaling pathway and regulate gene transcription. Without Wnt signal, cytoplasmic beta-catenin that is not associated with the cadherin complex is quickly phosphorylated at the N-terminal Ser/Thr residues by the so called degradation complex containing axin, adenomatous polyposis coli (APC), casein kinase I, and GSK3B, then ubiquitylated by beta-TrCP, and degraded by the proteasome. However, in the presence of Wnt signal, the degradation complex is disrupted and the stabilized cytoplasmic beta-catenin translocates into the nucleus, where it binds various transcription factors and, together with these factors, regulates the transcription of many downstream genes. Mutations of this gene have been linked with various types of tumors. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null embryos show anterior-posterior axis formation anomalies, but develop to E7. Multiple conditional mutations have shown defects in distinct stem cell types that result in proliferation defects, such as intestinal polyps, brain and spinal cord size anomalies, etc. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acrbp	C	T	6: 125,038,223 (GRCm39)		probably benign	Het
Ahnak	A	T	19: 8,987,907 (GRCm39)	I3064F	probably damaging	Het
Arhgef10l	C	A	4: 140,242,617 (GRCm39)	R884L	probably damaging	Het
Baiap2l2	A	G	15: 79,145,443 (GRCm39)	F317L	probably benign	Het
Brinp2	A	T	1: 158,077,021 (GRCm39)	I358N	probably damaging	Het
Ccin	A	G	4: 43,985,222 (GRCm39)	D543G	probably benign	Het
Cdh23	T	A	10: 60,167,572 (GRCm39)	D1806V	probably damaging	Het
Cdh6	C	T	15: 13,051,562 (GRCm39)	R357Q	probably benign	Het
Cpa3	T	C	3: 20,293,797 (GRCm39)	M64V	possibly damaging	Het
Cyp7a1	A	T	4: 6,272,307 (GRCm39)	I302N	probably damaging	Het
Dnase1l2	C	T	17: 24,661,446 (GRCm39)	A56T	probably benign	Het
Dscam	T	A	16: 96,634,633 (GRCm39)	D190V	probably damaging	Het
Fer1l4	T	C	2: 155,891,398 (GRCm39)		probably null	Het
Fscb	T	A	12: 64,520,242 (GRCm39)	D408V	probably benign	Het
Gm10306	A	G	4: 94,444,957 (GRCm39)		probably benign	Het
Gon4l	T	A	3: 88,765,803 (GRCm39)	M409K	probably benign	Het
Gsx2	T	C	5: 75,237,923 (GRCm39)	S292P	probably damaging	Het
Hira	T	A	16: 18,718,097 (GRCm39)		probably null	Het
Hoxa3	G	T	6: 52,149,386 (GRCm39)		probably null	Het
Irak3	T	C	10: 119,978,789 (GRCm39)	E554G	possibly damaging	Het
Itgb3bp	A	G	4: 99,657,724 (GRCm39)		probably benign	Het
Kifc3	C	T	8: 95,832,413 (GRCm39)	D379N	probably damaging	Het
Lama5	A	G	2: 179,837,213 (GRCm39)	V1032A	probably damaging	Het
Lmln	T	G	16: 32,908,546 (GRCm39)	I324R	probably benign	Het
Ltbp4	A	G	7: 27,005,501 (GRCm39)	S1547P	possibly damaging	Het
Mdga1	T	A	17: 30,069,522 (GRCm39)	T175S	probably damaging	Het
Mrps6	T	A	16: 91,855,346 (GRCm39)	L8*	probably null	Het
Mtmr11	A	C	3: 96,071,794 (GRCm39)	T203P	probably damaging	Het
Nat8f7	T	C	6: 85,684,552 (GRCm39)	D96G	probably damaging	Het
Obscn	T	C	11: 58,889,179 (GRCm39)	E7531G	unknown	Het
Or2k2	A	T	4: 58,785,115 (GRCm39)	S202R	probably damaging	Het
Or8k25	A	T	2: 86,243,855 (GRCm39)	D180E	probably damaging	Het
Or8k27	A	T	2: 86,275,772 (GRCm39)	L185I	probably benign	Het
Osbpl6	A	G	2: 76,380,063 (GRCm39)	Y69C	probably damaging	Het
Polrmt	C	T	10: 79,579,343 (GRCm39)	W136*	probably null	Het
Raver1	T	C	9: 20,990,886 (GRCm39)		probably benign	Het
Rims4	C	T	2: 163,705,849 (GRCm39)	V262M	possibly damaging	Het
Rsl1d1	T	C	16: 11,021,116 (GRCm39)	K2E	probably benign	Het
Sik3	C	T	9: 46,107,107 (GRCm39)	T417I	probably benign	Het
Spdl1	T	C	11: 34,710,117 (GRCm39)	K388R	possibly damaging	Het
Tulp1	T	C	17: 28,583,277 (GRCm39)	R88G	probably damaging	Het
Vldlr	A	C	19: 27,218,733 (GRCm39)	Y528S	probably damaging	Het
Zdhhc14	T	A	17: 5,543,924 (GRCm39)	L68H	probably damaging	Het
Zfp605	C	T	5: 110,275,860 (GRCm39)	T326I	probably benign	Het

Other mutations in Ctnnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0092:Ctnnb1	UTSW	9	120,781,929 (GRCm39)	missense	possibly damaging	0.78
R0326:Ctnnb1	UTSW	9	120,780,778 (GRCm39)	missense	probably benign	0.01
R0561:Ctnnb1	UTSW	9	120,780,788 (GRCm39)	missense	probably damaging	0.97
R1918:Ctnnb1	UTSW	9	120,780,100 (GRCm39)	missense	possibly damaging	0.80
R3892:Ctnnb1	UTSW	9	120,779,580 (GRCm39)	splice site	probably benign
R3915:Ctnnb1	UTSW	9	120,784,717 (GRCm39)	missense	probably benign	0.00
R4869:Ctnnb1	UTSW	9	120,782,060 (GRCm39)	missense	possibly damaging	0.93
R5707:Ctnnb1	UTSW	9	120,784,234 (GRCm39)	missense	probably benign	0.01
R6744:Ctnnb1	UTSW	9	120,782,025 (GRCm39)	missense	probably damaging	0.99
R7466:Ctnnb1	UTSW	9	120,784,482 (GRCm39)	missense	probably damaging	1.00
R7707:Ctnnb1	UTSW	9	120,781,931 (GRCm39)	missense	possibly damaging	0.77
R8434:Ctnnb1	UTSW	9	120,786,628 (GRCm39)	missense	possibly damaging	0.82
R8796:Ctnnb1	UTSW	9	120,784,498 (GRCm39)	missense	probably damaging	1.00
R8978:Ctnnb1	UTSW	9	120,786,650 (GRCm39)	missense	probably damaging	0.99
R9058:Ctnnb1	UTSW	9	120,780,476 (GRCm39)	nonsense	probably null
R9309:Ctnnb1	UTSW	9	120,784,504 (GRCm39)	missense	probably benign	0.03
R9712:Ctnnb1	UTSW	9	120,784,895 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGCAGCAGCAGTCTTACTTGG -3'
(R):5'- GCAAGTTCCGCGTCATCCTGATAG -3'

Sequencing Primer
(F):5'- AGCAGCAGTCTTACTTGGATTCTG -3'
(R):5'- TCATCTAGCGTCTCAGGGAAC -3'

Posted On

2014-01-05