Incidental Mutation 'R1017:Tulp1'
ID96508
Institutional Source Beutler Lab
Gene Symbol Tulp1
Ensembl Gene ENSMUSG00000037446
Gene Nametubby like protein 1
SynonymsTulp1l
MMRRC Submission 039121-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R1017 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28351515-28365182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28364303 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 88 (R88G)
Ref Sequence ENSEMBL: ENSMUSP00000110442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041819] [ENSMUST00000114794]
Predicted Effect probably damaging
Transcript: ENSMUST00000041819
AA Change: R88G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049070
Gene: ENSMUSG00000037446
AA Change: R88G

DomainStartEndE-ValueType
internal_repeat_1 17 65 8.47e-7 PROSPERO
low complexity region 111 142 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
internal_repeat_1 160 212 8.47e-7 PROSPERO
coiled coil region 242 266 N/A INTRINSIC
Pfam:Tub 299 537 1.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114794
AA Change: R88G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110442
Gene: ENSMUSG00000037446
AA Change: R88G

DomainStartEndE-ValueType
internal_repeat_1 17 65 8.5e-7 PROSPERO
low complexity region 111 142 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
internal_repeat_1 160 212 8.5e-7 PROSPERO
coiled coil region 242 266 N/A INTRINSIC
Pfam:Tub 299 449 3.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150341
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubby-like gene family (TULPs). Members of this family have been identified in plants, vertebrates, and invertebrates. TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. The protein encoded by this gene is thought to play a role in the physiology of photoreceptors. Mutations in this gene are associated with recessive juvenile retinitis pigmentosa and Leber congenital amaurosis-15. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutant mice exhibit retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp C T 6: 125,061,260 probably benign Het
Ahnak A T 19: 9,010,543 I3064F probably damaging Het
Arhgef10l C A 4: 140,515,306 R884L probably damaging Het
Baiap2l2 A G 15: 79,261,243 F317L probably benign Het
Brinp2 A T 1: 158,249,451 I358N probably damaging Het
Ccin A G 4: 43,985,222 D543G probably benign Het
Cdh23 T A 10: 60,331,793 D1806V probably damaging Het
Cdh6 C T 15: 13,051,476 R357Q probably benign Het
Cpa3 T C 3: 20,239,633 M64V possibly damaging Het
Ctnnb1 T A 9: 120,950,728 F74I probably damaging Het
Cyp7a1 A T 4: 6,272,307 I302N probably damaging Het
Dnase1l2 C T 17: 24,442,472 A56T probably benign Het
Dscam T A 16: 96,833,433 D190V probably damaging Het
Fer1l4 T C 2: 156,049,478 probably null Het
Fscb T A 12: 64,473,468 D408V probably benign Het
Gm10306 A G 4: 94,556,720 probably benign Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gsx2 T C 5: 75,077,262 S292P probably damaging Het
Hira T A 16: 18,899,347 probably null Het
Hoxa3 G T 6: 52,172,406 probably null Het
Irak3 T C 10: 120,142,884 E554G possibly damaging Het
Itgb3bp A G 4: 99,769,487 probably benign Het
Kifc3 C T 8: 95,105,785 D379N probably damaging Het
Lama5 A G 2: 180,195,420 V1032A probably damaging Het
Lmln T G 16: 33,088,176 I324R probably benign Het
Ltbp4 A G 7: 27,306,076 S1547P possibly damaging Het
Mdga1 T A 17: 29,850,548 T175S probably damaging Het
Mrps6 T A 16: 92,058,458 L8* probably null Het
Mtmr11 A C 3: 96,164,477 T203P probably damaging Het
Nat8f7 T C 6: 85,707,570 D96G probably damaging Het
Obscn T C 11: 58,998,353 E7531G unknown Het
Olfr1061 A T 2: 86,413,511 D180E probably damaging Het
Olfr1065 A T 2: 86,445,428 L185I probably benign Het
Olfr267 A T 4: 58,785,115 S202R probably damaging Het
Osbpl6 A G 2: 76,549,719 Y69C probably damaging Het
Polrmt C T 10: 79,743,509 W136* probably null Het
Raver1 T C 9: 21,079,590 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rsl1d1 T C 16: 11,203,252 K2E probably benign Het
Sik3 C T 9: 46,195,809 T417I probably benign Het
Spdl1 T C 11: 34,819,290 K388R possibly damaging Het
Vldlr A C 19: 27,241,333 Y528S probably damaging Het
Zdhhc14 T A 17: 5,493,649 L68H probably damaging Het
Zfp605 C T 5: 110,127,994 T326I probably benign Het
Other mutations in Tulp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Tulp1 APN 17 28356424 missense probably damaging 1.00
IGL01955:Tulp1 APN 17 28356424 missense probably damaging 1.00
IGL02388:Tulp1 APN 17 28358659 missense probably damaging 1.00
IGL02511:Tulp1 APN 17 28356168 missense probably benign 0.15
IGL02973:Tulp1 APN 17 28358542 splice site probably benign
IGL03054:Tulp1 APN 17 28359313 unclassified probably benign
IGL03248:Tulp1 APN 17 28359324 missense possibly damaging 0.87
R1543:Tulp1 UTSW 17 28362671 unclassified probably benign
R1593:Tulp1 UTSW 17 28362701 missense probably damaging 0.97
R1826:Tulp1 UTSW 17 28356367 missense possibly damaging 0.89
R2323:Tulp1 UTSW 17 28362482 missense probably damaging 1.00
R3840:Tulp1 UTSW 17 28353715 missense probably damaging 1.00
R3841:Tulp1 UTSW 17 28353715 missense probably damaging 1.00
R3930:Tulp1 UTSW 17 28353709 missense probably damaging 1.00
R4690:Tulp1 UTSW 17 28351837 unclassified probably benign
R4823:Tulp1 UTSW 17 28353572 missense probably benign 0.01
R4916:Tulp1 UTSW 17 28359135 missense probably damaging 1.00
R5024:Tulp1 UTSW 17 28351995 nonsense probably null
R5159:Tulp1 UTSW 17 28359060 critical splice donor site probably null
R5249:Tulp1 UTSW 17 28362677 unclassified probably benign
R5567:Tulp1 UTSW 17 28359198 missense possibly damaging 0.47
R6072:Tulp1 UTSW 17 28363784 missense possibly damaging 0.71
R6127:Tulp1 UTSW 17 28356150 missense probably benign
R6207:Tulp1 UTSW 17 28358677 unclassified probably benign
R6416:Tulp1 UTSW 17 28356031 makesense probably null
R6773:Tulp1 UTSW 17 28362902 missense probably damaging 1.00
R7242:Tulp1 UTSW 17 28363405 intron probably null
R7323:Tulp1 UTSW 17 28356424 missense probably damaging 1.00
X0024:Tulp1 UTSW 17 28353697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGCTCCAGAGGTTTAGTCCC -3'
(R):5'- TGGAATCCAAACCCCGTAAAGCTG -3'

Sequencing Primer
(F):5'- CTCATCTGGGGTACTTAAGGCTAC -3'
(R):5'- TAAAGCTGGGGGTGAGTCC -3'
Posted On2014-01-05