Incidental Mutation 'R1110:Col6a2'
ID96655
Institutional Source Beutler Lab
Gene Symbol Col6a2
Ensembl Gene ENSMUSG00000020241
Gene Namecollagen, type VI, alpha 2
SynonymsCol6a-2
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1110 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76595762-76623630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76607740 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 497 (E497G)
Ref Sequence ENSEMBL: ENSMUSP00000101053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001181] [ENSMUST00000105413]
Predicted Effect probably benign
Transcript: ENSMUST00000001181
AA Change: E497G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001181
Gene: ENSMUSG00000020241
AA Change: E497G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 59 246 9.55e-29 SMART
Pfam:Collagen 269 329 3.3e-11 PFAM
Pfam:Collagen 317 383 6.2e-10 PFAM
Pfam:Collagen 366 430 2.2e-8 PFAM
Pfam:Collagen 424 483 1.7e-9 PFAM
low complexity region 502 517 N/A INTRINSIC
Pfam:Collagen 546 605 1.1e-9 PFAM
VWA 628 816 7.51e-36 SMART
VWA 846 1029 3.97e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105413
AA Change: E497G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101053
Gene: ENSMUSG00000020241
AA Change: E497G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 59 246 9.55e-29 SMART
Pfam:Collagen 269 330 5.2e-12 PFAM
Pfam:Collagen 316 384 6.1e-10 PFAM
Pfam:Collagen 364 431 1.4e-8 PFAM
Pfam:Collagen 424 483 5.3e-10 PFAM
Pfam:Collagen 475 542 3.3e-9 PFAM
Pfam:Collagen 531 605 7.4e-8 PFAM
VWA 628 816 7.51e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137365
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The product of this gene contains several domains similar to von Willebrand Factor type A domains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in this gene are associated with Bethlem myopathy and Ullrich scleroatonic muscular dystrophy. Three transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Col6a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Col6a2 APN 10 76614534 missense probably damaging 0.96
IGL01995:Col6a2 APN 10 76604842 splice site probably benign
IGL02005:Col6a2 APN 10 76610173 missense probably damaging 1.00
IGL02793:Col6a2 APN 10 76596310 missense possibly damaging 0.96
IGL03144:Col6a2 APN 10 76614425 missense probably benign
piddling UTSW 10 76608106 critical splice donor site probably null
R0137:Col6a2 UTSW 10 76596425 missense probably damaging 1.00
R0371:Col6a2 UTSW 10 76614473 missense probably benign 0.25
R0423:Col6a2 UTSW 10 76614917 missense possibly damaging 0.85
R0554:Col6a2 UTSW 10 76611161 critical splice donor site probably null
R0781:Col6a2 UTSW 10 76607740 missense probably benign 0.00
R0831:Col6a2 UTSW 10 76604105 missense probably damaging 1.00
R1499:Col6a2 UTSW 10 76603710 missense probably damaging 1.00
R1502:Col6a2 UTSW 10 76614678 missense probably benign 0.00
R1854:Col6a2 UTSW 10 76614812 missense probably damaging 0.98
R1878:Col6a2 UTSW 10 76614788 missense probably benign 0.00
R3410:Col6a2 UTSW 10 76603359 missense probably benign 0.17
R4110:Col6a2 UTSW 10 76606169 splice site probably null
R4242:Col6a2 UTSW 10 76608106 critical splice donor site probably null
R5562:Col6a2 UTSW 10 76599675 nonsense probably null
R5603:Col6a2 UTSW 10 76596769 missense probably damaging 1.00
R5641:Col6a2 UTSW 10 76613278 missense probably damaging 1.00
R5681:Col6a2 UTSW 10 76609251 splice site probably null
R5707:Col6a2 UTSW 10 76611031 missense possibly damaging 0.95
R5735:Col6a2 UTSW 10 76599893 missense probably benign 0.32
R5789:Col6a2 UTSW 10 76604389 missense probably damaging 1.00
R6134:Col6a2 UTSW 10 76607144 missense probably damaging 0.97
R6156:Col6a2 UTSW 10 76604170 missense possibly damaging 0.92
R6208:Col6a2 UTSW 10 76615057 missense possibly damaging 0.88
R6296:Col6a2 UTSW 10 76611049 missense probably damaging 1.00
R6328:Col6a2 UTSW 10 76614378 missense possibly damaging 0.67
R6329:Col6a2 UTSW 10 76599828 missense probably benign 0.01
R6722:Col6a2 UTSW 10 76614558 missense probably damaging 0.98
R7012:Col6a2 UTSW 10 76614677 missense possibly damaging 0.95
R7091:Col6a2 UTSW 10 76615091 missense unknown
Predicted Primers PCR Primer
(F):5'- TGATTTGACCAGCTCTGAGAAGATTGC -3'
(R):5'- AGATCTGTGCCCAGTACCTCTCTTAAC -3'

Sequencing Primer
(F):5'- GTAGCAGAGCCACCACCTTG -3'
(R):5'- TTCTCTCAGACCCAGCCAAG -3'
Posted On2014-01-05