Incidental Mutation 'R1019:Tgm2'
ID 96706
Institutional Source Beutler Lab
Gene Symbol Tgm2
Ensembl Gene ENSMUSG00000037820
Gene Name transglutaminase 2, C polypeptide
Synonyms TG2, TG C, tissue transglutaminase, protein-glutamine gamma-glutamyltransferase, G[a]h, tTGas, TGase2, tTG
MMRRC Submission 039123-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R1019 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 157958325-157988312 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 157966074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 527 (E527*)
Ref Sequence ENSEMBL: ENSMUSP00000099411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103122] [ENSMUST00000152452] [ENSMUST00000174718]
AlphaFold P21981
Predicted Effect probably null
Transcript: ENSMUST00000103122
AA Change: E527*
SMART Domains Protein: ENSMUSP00000099411
Gene: ENSMUSG00000037820
AA Change: E527*

DomainStartEndE-ValueType
Pfam:Transglut_N 6 122 3.6e-34 PFAM
TGc 269 361 1.11e-38 SMART
Pfam:Transglut_C 473 572 5.7e-29 PFAM
Pfam:Transglut_C 586 685 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152452
SMART Domains Protein: ENSMUSP00000118434
Gene: ENSMUSG00000027651

DomainStartEndE-ValueType
RPR 8 130 1.71e-53 SMART
low complexity region 132 145 N/A INTRINSIC
PDB:4FLA|D 171 222 3e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174718
SMART Domains Protein: ENSMUSP00000133662
Gene: ENSMUSG00000037820

DomainStartEndE-ValueType
Pfam:Transglut_N 5 124 1.9e-37 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene acts as a monomer, is induced by retinoic acid, and appears to be involved in apoptosis. Finally, the encoded protein is the autoantigen implicated in celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous null mutation causes alterations in glucose and aerobic energy metabolism, tumor growth, and response to myocardial infarction, liver injury, and LPS-induced sepsis. A second null mutation confers resistance to renal injury, while a third one alters cell adhesion and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,872,209 (GRCm39) E46Q probably damaging Het
9130401M01Rik A G 15: 57,885,823 (GRCm39) I353T possibly damaging Het
A830031A19Rik G A 11: 23,999,438 (GRCm39) R53C unknown Het
Abcc6 T C 7: 45,663,531 (GRCm39) R378G possibly damaging Het
Adam10 A G 9: 70,668,922 (GRCm39) N413D probably benign Het
Csmd2 T C 4: 128,415,807 (GRCm39) V2712A probably benign Het
Dnhd1 T C 7: 105,358,378 (GRCm39) F3289S probably damaging Het
Hectd1 A G 12: 51,795,440 (GRCm39) S2330P probably damaging Het
Ift74 C T 4: 94,524,072 (GRCm39) A196V probably benign Het
Kifc1 G A 17: 34,103,685 (GRCm39) R195C probably benign Het
Lipo2 A T 19: 33,708,257 (GRCm39) C252* probably null Het
Mrgpra1 C G 7: 46,984,833 (GRCm39) C282S probably benign Het
Nfatc2 A T 2: 168,346,799 (GRCm39) L765Q probably damaging Het
Or13a26 C T 7: 140,284,407 (GRCm39) P81L probably damaging Het
Or1l8 A G 2: 36,817,764 (GRCm39) F121L probably benign Het
Otof C A 5: 30,528,087 (GRCm39) V1924L probably damaging Het
Pdhb T C 14: 8,171,442 (GRCm38) Q62R probably benign Het
Plbd1 A G 6: 136,628,903 (GRCm39) V55A probably benign Het
Poteg T A 8: 27,937,852 (GRCm39) F3I possibly damaging Het
Rptor A G 11: 119,734,569 (GRCm39) D46G probably damaging Het
Slc18a1 C T 8: 69,527,685 (GRCm39) probably null Het
Slc37a1 A G 17: 31,534,568 (GRCm39) N80S probably benign Het
Slc6a18 T A 13: 73,825,998 (GRCm39) R17S probably damaging Het
Spata31d1a A G 13: 59,850,182 (GRCm39) S649P probably benign Het
Syngr3 G T 17: 24,906,534 (GRCm39) Q94K possibly damaging Het
Tnc T A 4: 63,880,319 (GRCm39) T1952S probably damaging Het
Ubqln3 C T 7: 103,790,593 (GRCm39) R499Q probably benign Het
Uck1 A G 2: 32,146,205 (GRCm39) V230A possibly damaging Het
Unc13d G A 11: 115,958,900 (GRCm39) R754C probably benign Het
Zfp708 C T 13: 67,222,162 (GRCm39) A73T probably benign Het
Other mutations in Tgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Tgm2 APN 2 157,966,051 (GRCm39) missense probably benign
IGL03110:Tgm2 APN 2 157,973,410 (GRCm39) nonsense probably null
IGL03397:Tgm2 APN 2 157,962,178 (GRCm39) missense probably damaging 1.00
R0595:Tgm2 UTSW 2 157,984,962 (GRCm39) missense probably damaging 1.00
R0786:Tgm2 UTSW 2 157,966,301 (GRCm39) missense probably damaging 1.00
R1395:Tgm2 UTSW 2 157,966,172 (GRCm39) missense probably benign 0.01
R1732:Tgm2 UTSW 2 157,976,277 (GRCm39) missense probably damaging 1.00
R1776:Tgm2 UTSW 2 157,973,379 (GRCm39) missense probably benign 0.00
R1863:Tgm2 UTSW 2 157,966,139 (GRCm39) missense probably damaging 1.00
R2863:Tgm2 UTSW 2 157,985,019 (GRCm39) missense probably benign 0.01
R3036:Tgm2 UTSW 2 157,966,167 (GRCm39) missense probably benign 0.00
R4200:Tgm2 UTSW 2 157,974,410 (GRCm39) missense probably benign
R4370:Tgm2 UTSW 2 157,966,221 (GRCm39) nonsense probably null
R4612:Tgm2 UTSW 2 157,966,124 (GRCm39) missense probably benign 0.16
R5100:Tgm2 UTSW 2 157,969,084 (GRCm39) missense probably benign 0.33
R5213:Tgm2 UTSW 2 157,984,980 (GRCm39) missense possibly damaging 0.88
R5253:Tgm2 UTSW 2 157,971,358 (GRCm39) missense probably damaging 1.00
R5585:Tgm2 UTSW 2 157,973,375 (GRCm39) nonsense probably null
R5593:Tgm2 UTSW 2 157,969,262 (GRCm39) missense probably damaging 1.00
R5616:Tgm2 UTSW 2 157,970,640 (GRCm39) missense probably damaging 1.00
R5796:Tgm2 UTSW 2 157,960,824 (GRCm39) missense probably benign 0.00
R5821:Tgm2 UTSW 2 157,984,974 (GRCm39) missense possibly damaging 0.81
R5842:Tgm2 UTSW 2 157,985,001 (GRCm39) missense probably damaging 1.00
R6317:Tgm2 UTSW 2 157,966,070 (GRCm39) missense probably benign 0.18
R6610:Tgm2 UTSW 2 157,985,020 (GRCm39) nonsense probably null
R7134:Tgm2 UTSW 2 157,980,812 (GRCm39) missense probably benign
R7151:Tgm2 UTSW 2 157,971,315 (GRCm39) missense possibly damaging 0.95
R7268:Tgm2 UTSW 2 157,962,188 (GRCm39) nonsense probably null
R7719:Tgm2 UTSW 2 157,985,038 (GRCm39) missense probably damaging 1.00
R8728:Tgm2 UTSW 2 157,962,065 (GRCm39) missense probably benign 0.02
R9389:Tgm2 UTSW 2 157,959,816 (GRCm39) missense probably benign 0.19
R9460:Tgm2 UTSW 2 157,971,241 (GRCm39) critical splice donor site probably null
R9509:Tgm2 UTSW 2 157,969,210 (GRCm39) nonsense probably null
R9518:Tgm2 UTSW 2 157,985,049 (GRCm39) missense probably benign 0.03
R9781:Tgm2 UTSW 2 157,971,321 (GRCm39) missense probably damaging 1.00
X0058:Tgm2 UTSW 2 157,966,067 (GRCm39) missense probably benign 0.01
X0067:Tgm2 UTSW 2 157,960,765 (GRCm39) critical splice donor site probably null
Z1177:Tgm2 UTSW 2 157,959,819 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTGAGAGAGCCAGCAAACTCAT -3'
(R):5'- CACCTGAACAAACTGGCAGAGAAAGA -3'

Sequencing Primer
(F):5'- atcccatagaacacaaaaatccag -3'
(R):5'- CTGGCAGAGAAAGAGGAGAC -3'
Posted On 2014-01-05