Incidental Mutation 'R1112:Fxr2'
ID96859
Institutional Source Beutler Lab
Gene Symbol Fxr2
Ensembl Gene ENSMUSG00000018765
Gene Namefragile X mental retardation, autosomal homolog 2
SynonymsFxr2h
MMRRC Submission 039185-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R1112 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69632990-69653297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69652248 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 624 (S624G)
Ref Sequence ENSEMBL: ENSMUSP00000018909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018905] [ENSMUST00000018909] [ENSMUST00000047373] [ENSMUST00000148242] [ENSMUST00000155200]
Predicted Effect probably benign
Transcript: ENSMUST00000018905
SMART Domains Protein: ENSMUSP00000018905
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
low complexity region 141 157 N/A INTRINSIC
CTNS 167 198 5.56e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000018909
AA Change: S624G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018909
Gene: ENSMUSG00000018765
AA Change: S624G

DomainStartEndE-ValueType
Pfam:Agenet 72 130 1.3e-10 PFAM
KH 227 294 3.06e-3 SMART
KH 295 366 4.16e-5 SMART
low complexity region 368 380 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 475 503 N/A INTRINSIC
Pfam:FXR_C1 504 579 2.5e-36 PFAM
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047373
SMART Domains Protein: ENSMUSP00000048524
Gene: ENSMUSG00000041287

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
HMG 46 116 6.83e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125389
SMART Domains Protein: ENSMUSP00000129025
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
CTNS 39 70 1.69e-6 SMART
low complexity region 89 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127118
Predicted Effect probably benign
Transcript: ENSMUST00000129224
SMART Domains Protein: ENSMUSP00000120001
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
CTNS 54 85 1.69e-6 SMART
low complexity region 138 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139605
Predicted Effect probably benign
Transcript: ENSMUST00000148242
SMART Domains Protein: ENSMUSP00000133074
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
low complexity region 98 109 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149764
Predicted Effect probably benign
Transcript: ENSMUST00000155200
SMART Domains Protein: ENSMUSP00000117715
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RNA binding protein containing two KH domains and one RCG box, which is similar to FMRP and FXR1. It associates with polyribosomes, predominantly with 60S large ribosomal subunits. This encoded protein may self-associate or interact with FMRP and FXR1. It may have a role in the development of fragile X mental retardation syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hyperactivity, impaired Morris water task performance, and reductions in prepulse inhibition, contextual conditioned fear, and sensitivity to heat stimulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,713,572 N122D probably benign Het
Atrn A G 2: 130,999,161 D1161G probably benign Het
Bscl2 G C 19: 8,839,734 G9R possibly damaging Het
Clstn2 T C 9: 97,458,228 N697S possibly damaging Het
Ctnnd2 T C 15: 30,921,880 V884A probably damaging Het
Dusp10 A T 1: 184,036,900 Q21L probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam172a A G 13: 77,761,886 Y40C probably damaging Het
Foxn1 A G 11: 78,371,030 F171S probably benign Het
Gorasp2 C A 2: 70,690,814 P376Q probably benign Het
Gpr33 A G 12: 52,023,372 S295P probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hap1 C T 11: 100,354,317 V23M probably damaging Het
Hsd3b5 C T 3: 98,630,077 R41Q probably benign Het
Kif1c T G 11: 70,724,815 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd A G 2: 91,143,599 C1447R probably damaging Het
Myef2 A C 2: 125,097,586 M426R probably damaging Het
Myh13 A T 11: 67,354,750 D1072V probably damaging Het
Olfr394 A C 11: 73,888,234 L46R probably damaging Het
Olfr586 C T 7: 103,122,404 D123N probably damaging Het
Orc4 A T 2: 48,933,572 N90K probably damaging Het
Padi4 C T 4: 140,758,116 S246N probably benign Het
Pcdhb22 A T 18: 37,519,768 T430S possibly damaging Het
Prkd3 T C 17: 78,966,408 D473G probably damaging Het
Scn4a T C 11: 106,320,466 Y1575C probably damaging Het
Serpinb6d A G 13: 33,669,135 Y170C probably damaging Het
Slc12a2 A T 18: 57,937,752 I1059L probably benign Het
Slc36a4 T A 9: 15,723,515 F118I possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srpr A G 9: 35,214,959 T483A probably benign Het
Sycp2 A T 2: 178,352,536 D1198E probably benign Het
Ubash3b T C 9: 41,028,116 N287D probably damaging Het
Uggt1 T C 1: 36,173,546 D905G possibly damaging Het
Zfp692 T C 11: 58,311,562 L381P probably damaging Het
Other mutations in Fxr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Fxr2 APN 11 69642139 missense possibly damaging 0.77
IGL00595:Fxr2 APN 11 69649192 missense probably benign 0.01
IGL00659:Fxr2 APN 11 69640250 missense probably benign 0.12
IGL00921:Fxr2 APN 11 69652240 missense probably damaging 1.00
IGL01025:Fxr2 APN 11 69643887 missense probably damaging 1.00
IGL01154:Fxr2 APN 11 69641433 splice site probably benign
IGL01347:Fxr2 APN 11 69652288 missense probably benign 0.27
IGL01743:Fxr2 APN 11 69652622 missense possibly damaging 0.53
IGL01981:Fxr2 APN 11 69650502 missense possibly damaging 0.95
IGL02332:Fxr2 APN 11 69649838 critical splice donor site probably null
IGL02385:Fxr2 APN 11 69652269 missense possibly damaging 0.82
IGL03172:Fxr2 APN 11 69649839 critical splice donor site probably null
R0092:Fxr2 UTSW 11 69642146 splice site probably benign
R0720:Fxr2 UTSW 11 69639415 missense probably benign 0.03
R1344:Fxr2 UTSW 11 69648884 missense possibly damaging 0.68
R1635:Fxr2 UTSW 11 69641313 missense possibly damaging 0.77
R1864:Fxr2 UTSW 11 69652277 missense probably benign 0.30
R1957:Fxr2 UTSW 11 69643940 missense probably benign 0.03
R1992:Fxr2 UTSW 11 69649833 missense possibly damaging 0.92
R2243:Fxr2 UTSW 11 69642070 missense possibly damaging 0.93
R2863:Fxr2 UTSW 11 69639427 missense probably damaging 1.00
R2865:Fxr2 UTSW 11 69639427 missense probably damaging 1.00
R5255:Fxr2 UTSW 11 69643841 missense probably benign 0.03
R5726:Fxr2 UTSW 11 69633346 missense probably benign 0.00
R5899:Fxr2 UTSW 11 69652685 missense probably damaging 1.00
R6045:Fxr2 UTSW 11 69651051 missense possibly damaging 0.90
R6146:Fxr2 UTSW 11 69641339 missense possibly damaging 0.82
R6149:Fxr2 UTSW 11 69649204 missense probably benign 0.05
R6195:Fxr2 UTSW 11 69652273 missense probably benign 0.30
R6622:Fxr2 UTSW 11 69641590 critical splice donor site probably null
R7381:Fxr2 UTSW 11 69642049 missense possibly damaging 0.89
R7382:Fxr2 UTSW 11 69641556 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATCGTGGTAACCGGACTGATGGG -3'
(R):5'- CTGATGAGTACAGCAGATGCAGGC -3'

Sequencing Primer
(F):5'- TCAGTGGAGACCGCCAAC -3'
(R):5'- AGCTTAGCCTGAACTCCATC -3'
Posted On2014-01-05