Incidental Mutation 'R1112:Scn4a'
ID96873
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission 039185-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1112 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106320466 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1575 (Y1575C)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably damaging
Transcript: ENSMUST00000021056
AA Change: Y1575C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: Y1575C

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,713,572 N122D probably benign Het
Atrn A G 2: 130,999,161 D1161G probably benign Het
Bscl2 G C 19: 8,839,734 G9R possibly damaging Het
Clstn2 T C 9: 97,458,228 N697S possibly damaging Het
Ctnnd2 T C 15: 30,921,880 V884A probably damaging Het
Dusp10 A T 1: 184,036,900 Q21L probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam172a A G 13: 77,761,886 Y40C probably damaging Het
Foxn1 A G 11: 78,371,030 F171S probably benign Het
Fxr2 A G 11: 69,652,248 S624G probably damaging Het
Gorasp2 C A 2: 70,690,814 P376Q probably benign Het
Gpr33 A G 12: 52,023,372 S295P probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hap1 C T 11: 100,354,317 V23M probably damaging Het
Hsd3b5 C T 3: 98,630,077 R41Q probably benign Het
Kif1c T G 11: 70,724,815 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd A G 2: 91,143,599 C1447R probably damaging Het
Myef2 A C 2: 125,097,586 M426R probably damaging Het
Myh13 A T 11: 67,354,750 D1072V probably damaging Het
Olfr394 A C 11: 73,888,234 L46R probably damaging Het
Olfr586 C T 7: 103,122,404 D123N probably damaging Het
Orc4 A T 2: 48,933,572 N90K probably damaging Het
Padi4 C T 4: 140,758,116 S246N probably benign Het
Pcdhb22 A T 18: 37,519,768 T430S possibly damaging Het
Prkd3 T C 17: 78,966,408 D473G probably damaging Het
Serpinb6d A G 13: 33,669,135 Y170C probably damaging Het
Slc12a2 A T 18: 57,937,752 I1059L probably benign Het
Slc36a4 T A 9: 15,723,515 F118I possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srpr A G 9: 35,214,959 T483A probably benign Het
Sycp2 A T 2: 178,352,536 D1198E probably benign Het
Ubash3b T C 9: 41,028,116 N287D probably damaging Het
Uggt1 T C 1: 36,173,546 D905G possibly damaging Het
Zfp692 T C 11: 58,311,562 L381P probably damaging Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 intron probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGCATCCATTTCCCCAGAGTCAC -3'
(R):5'- ATCTGCCTCTTCGAGATCACCACG -3'

Sequencing Primer
(F):5'- GGCAATTTTCAAGGGCTCC -3'
(R):5'- TTCGAGATCACCACGTCAGC -3'
Posted On2014-01-05