Incidental Mutation 'R1113:Prkcg'
ID 96933
Institutional Source Beutler Lab
Gene Symbol Prkcg
Ensembl Gene ENSMUSG00000078816
Gene Name protein kinase C, gamma
Synonyms PKCgamma, Prkcc, Pkcc
MMRRC Submission 039186-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1113 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 3352038-3379615 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 3377622 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 525 (K525N)
Ref Sequence ENSEMBL: ENSMUSP00000131351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092891] [ENSMUST00000100301] [ENSMUST00000172109]
AlphaFold P63318
Predicted Effect probably benign
Transcript: ENSMUST00000092891
SMART Domains Protein: ENSMUSP00000090567
Gene: ENSMUSG00000069806

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 196 4.4e-22 PFAM
Pfam:Claudin_2 18 197 2.5e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100301
AA Change: K576N

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097874
Gene: ENSMUSG00000078816
AA Change: K576N

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
low complexity region 319 331 N/A INTRINSIC
S_TKc 351 614 1.37e-94 SMART
S_TK_X 615 677 1.77e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172109
AA Change: K525N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131351
Gene: ENSMUSG00000078816
AA Change: K525N

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
S_TKc 309 563 2.73e-80 SMART
S_TK_X 564 626 1.77e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203454
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 93.0%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Depending upon genetic background, homozygous null mice show mild deficits in spatial learning and contextual conditioning. Genotype-dependent reductions in sensitivity to the effects of ethanol on righting reflex and hypothermia, in neuropathic pain after injury, and in anxiety are also evident. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak G A 19: 8,982,984 (GRCm39) E1423K probably benign Het
Angpt2 C T 8: 18,742,134 (GRCm39) W474* probably null Het
Cln6 A G 9: 62,758,143 (GRCm39) T301A probably damaging Het
G6pc2 A T 2: 69,050,570 (GRCm39) D65V probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Map3k6 T C 4: 132,973,126 (GRCm39) S395P probably damaging Het
Myo6 G A 9: 80,152,996 (GRCm39) V210I probably damaging Het
Otoa C A 7: 120,724,666 (GRCm39) C448* probably null Het
Pate6 T C 9: 35,700,385 (GRCm39) T67A probably benign Het
Pros1 G A 16: 62,734,228 (GRCm39) D345N probably damaging Het
Prss47 T C 13: 65,199,630 (GRCm39) H83R probably benign Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Tekt2 A T 4: 126,218,711 (GRCm39) L14H probably damaging Het
Tnpo2 T C 8: 85,781,982 (GRCm39) F857S probably damaging Het
Try4 G T 6: 41,282,308 (GRCm39) Q209H possibly damaging Het
Wdfy4 G A 14: 32,693,695 (GRCm39) S2710L possibly damaging Het
Other mutations in Prkcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Prkcg APN 7 3,368,135 (GRCm39) missense probably benign 0.27
IGL01551:Prkcg APN 7 3,352,342 (GRCm39) unclassified probably benign
IGL02167:Prkcg APN 7 3,371,097 (GRCm39) critical splice donor site probably null
IGL02434:Prkcg APN 7 3,367,406 (GRCm39) missense probably benign
R0044:Prkcg UTSW 7 3,363,517 (GRCm39) intron probably benign
R0164:Prkcg UTSW 7 3,377,635 (GRCm39) missense probably damaging 1.00
R0164:Prkcg UTSW 7 3,377,635 (GRCm39) missense probably damaging 1.00
R0413:Prkcg UTSW 7 3,368,095 (GRCm39) missense probably benign 0.00
R0417:Prkcg UTSW 7 3,352,820 (GRCm39) critical splice acceptor site probably null
R1170:Prkcg UTSW 7 3,368,177 (GRCm39) missense probably damaging 0.97
R1308:Prkcg UTSW 7 3,377,622 (GRCm39) missense probably damaging 1.00
R1634:Prkcg UTSW 7 3,371,986 (GRCm39) missense probably damaging 1.00
R1978:Prkcg UTSW 7 3,353,862 (GRCm39) missense probably damaging 1.00
R2016:Prkcg UTSW 7 3,372,066 (GRCm39) missense probably damaging 0.98
R2209:Prkcg UTSW 7 3,352,097 (GRCm39) unclassified probably benign
R3788:Prkcg UTSW 7 3,362,263 (GRCm39) missense probably damaging 0.99
R4006:Prkcg UTSW 7 3,375,983 (GRCm39) missense probably damaging 0.96
R4853:Prkcg UTSW 7 3,367,469 (GRCm39) missense probably damaging 0.99
R4915:Prkcg UTSW 7 3,378,781 (GRCm39) nonsense probably null
R4916:Prkcg UTSW 7 3,378,781 (GRCm39) nonsense probably null
R4997:Prkcg UTSW 7 3,371,097 (GRCm39) critical splice donor site probably null
R5446:Prkcg UTSW 7 3,378,780 (GRCm39) missense probably benign 0.00
R5646:Prkcg UTSW 7 3,377,597 (GRCm39) missense probably damaging 0.97
R5677:Prkcg UTSW 7 3,371,974 (GRCm39) missense probably damaging 1.00
R6913:Prkcg UTSW 7 3,362,335 (GRCm39) missense probably benign 0.02
R7355:Prkcg UTSW 7 3,372,025 (GRCm39) missense possibly damaging 0.94
R7371:Prkcg UTSW 7 3,368,069 (GRCm39) missense probably benign 0.27
R7544:Prkcg UTSW 7 3,359,081 (GRCm39) missense probably benign 0.00
R7649:Prkcg UTSW 7 3,378,480 (GRCm39) missense probably benign 0.09
R7742:Prkcg UTSW 7 3,378,459 (GRCm39) missense possibly damaging 0.84
R8009:Prkcg UTSW 7 3,362,708 (GRCm39) missense probably benign
R8074:Prkcg UTSW 7 3,372,037 (GRCm39) missense probably damaging 1.00
R8296:Prkcg UTSW 7 3,377,580 (GRCm39) missense probably benign 0.37
R8344:Prkcg UTSW 7 3,378,686 (GRCm39) missense probably damaging 1.00
R8887:Prkcg UTSW 7 3,370,857 (GRCm39) missense possibly damaging 0.94
R9343:Prkcg UTSW 7 3,359,124 (GRCm39) missense possibly damaging 0.55
R9426:Prkcg UTSW 7 3,375,975 (GRCm39) missense probably damaging 1.00
R9530:Prkcg UTSW 7 3,375,965 (GRCm39) missense possibly damaging 0.89
R9605:Prkcg UTSW 7 3,359,360 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGACAGTAGAGTGATGCACAGAACT -3'
(R):5'- GATGACTCAGCAAGACCCATGAAGAAT -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- GATTAGGGGTAATCTGACCCATC -3'
Posted On 2014-01-05