Incidental Mutation 'R1114:Cd247'
ID96984
Institutional Source Beutler Lab
Gene Symbol Cd247
Ensembl Gene ENSMUSG00000005763
Gene NameCD247 antigen
SynonymsCD3-zeta, CD3 zeta, Tcrz, T3z, Cd3h, TCRk, CD3-zeta/eta, Cd3z, CD3zeta, 4930549J05Rik, CD3-eta
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1114 (G1)
Quality Score159
Status Validated
Chromosome1
Chromosomal Location165788681-165877277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165788838 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 4 (K4E)
Ref Sequence ENSEMBL: ENSMUSP00000136456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005907] [ENSMUST00000027849] [ENSMUST00000086002] [ENSMUST00000161559] [ENSMUST00000161971] [ENSMUST00000178336] [ENSMUST00000187313]
Predicted Effect probably benign
Transcript: ENSMUST00000005907
AA Change: K4E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000005907
Gene: ENSMUSG00000005763
AA Change: K4E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 1.7e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
ITAM 139 159 6.45e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000027849
AA Change: K4E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027849
Gene: ENSMUSG00000005763
AA Change: K4E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 58 4.3e-21 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
low complexity region 195 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086002
AA Change: K4E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000083165
Gene: ENSMUSG00000005763
AA Change: K4E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 2.5e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
low complexity region 195 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159138
Predicted Effect probably benign
Transcript: ENSMUST00000161559
AA Change: K4E

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124299
Gene: ENSMUSG00000005763
AA Change: K4E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 1.7e-24 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 107 128 1.27e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161971
AA Change: K4E

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124297
Gene: ENSMUSG00000005763
AA Change: K4E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 1.5e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178336
AA Change: K4E

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136456
Gene: ENSMUSG00000005763
AA Change: K4E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 1.7e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187313
AA Change: K4E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140926
Gene: ENSMUSG00000005763
AA Change: K4E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TCR_zetazeta 28 60 2.5e-23 PFAM
ITAM 69 89 6.91e-5 SMART
ITAM 108 129 1.27e-3 SMART
low complexity region 195 204 N/A INTRINSIC
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is T-cell receptor zeta, which together with T-cell receptor alpha/beta and gamma/delta heterodimers, and with CD3-gamma, -delta and -epsilon, forms the T-cell receptor-CD3 complex. The zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. Low expression of the antigen results in impaired immune response. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit greatly reduced numbers of CD4+CD8+ cells, and near absence of CD4+CD8-, CD4-CD8+ cells, and TCR expression in the thymus, but the presence of single positive T cells in lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Cd247
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02869:Cd247 APN 1 165857417 missense probably damaging 1.00
allia UTSW 1 165855214 missense probably damaging 1.00
PIT4445001:Cd247 UTSW 1 165861036 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGACGGATGCACATTCTTACACC -3'
(R):5'- CCCGTTGACTTTGGGAAGACAAGC -3'

Sequencing Primer
(F):5'- GAACTTCCTGCCTATGAATCGAG -3'
(R):5'- GCTTTAAAAGAAGCACCAGGTC -3'
Posted On2014-01-05