Mutagenetix > Incidental Mutation

Incidental Mutation 'R1114:Dusp12'

96986

Institutional Source

Beutler Lab

Gene Symbol

Dusp12

Ensembl Gene

ENSMUSG00000026659

Gene Name

dual specificity phosphatase 12

Synonyms

T-DSP4, LMW-DSP4, VH1, 1190004O14Rik, ESTM36, mVH1

MMRRC Submission

039187-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1114 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

170701756-170713109 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 170708586 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 48 (V48G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027970] [ENSMUST00000046476] [ENSMUST00000163252] [ENSMUST00000170420] [ENSMUST00000172042] [ENSMUST00000180542]

AlphaFold

Q9D0T2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027970
AA Change: V118G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000027970
Gene: ENSMUSG00000026659
AA Change: V118G

Domain	Start	End	E-Value	Type
DSPc	26	167	1.23e-30	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000046476
AA Change: V118G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000044320
Gene: ENSMUSG00000026659
AA Change: V118G

Domain	Start	End	E-Value	Type
DSPc	26	157	5.96e-20	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000163252
AA Change: S118R

SMART Domains

Protein: ENSMUSP00000126676
Gene: ENSMUSG00000026659
AA Change: S118R

Domain	Start	End	E-Value	Type
Pfam:DSPc	30	115	2e-8	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000166393
AA Change: S118R

SMART Domains

Protein: ENSMUSP00000130507
Gene: ENSMUSG00000026659
AA Change: S118R

Domain	Start	End	E-Value	Type
Pfam:DSPc	31	121	8.5e-9	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000170420
AA Change: S122R

SMART Domains

Protein: ENSMUSP00000129515
Gene: ENSMUSG00000026659
AA Change: S122R

Domain	Start	End	E-Value	Type
PTPc_DSPc	26	136	4e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171447
AA Change: V48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130683
Gene: ENSMUSG00000026659
AA Change: V48G

Domain	Start	End	E-Value	Type
Pfam:DSPc	3	98	6.9e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171747

Predicted Effect

probably benign
Transcript: ENSMUST00000172042

Predicted Effect

probably benign
Transcript: ENSMUST00000180542

Meta Mutation Damage Score

0.9000

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.5%
20x: 84.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is the human ortholog of the Saccharomyces cerevisiae YVH1 protein tyrosine phosphatase. It is localized predominantly in the nucleus, and is novel in that it contains, and is regulated by a zinc finger domain. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700128F08Rik	T	A	9: 8,222,179 (GRCm39)		noncoding transcript	Het
Acss3	T	A	10: 106,824,740 (GRCm39)	R422S	possibly damaging	Het
Asb15	G	A	6: 24,567,176 (GRCm39)	R499H	probably damaging	Het
Aspm	C	T	1: 139,389,662 (GRCm39)		probably benign	Het
Camk2d	G	A	3: 126,633,941 (GRCm39)	V488M	probably damaging	Het
Cd247	A	G	1: 165,616,407 (GRCm39)	K4E	probably benign	Het
Cdh20	A	G	1: 104,906,739 (GRCm39)	D522G	probably damaging	Het
Cse1l	T	A	2: 166,783,123 (GRCm39)		probably benign	Het
Dctn2	T	A	10: 127,114,011 (GRCm39)		probably null	Het
Dpy19l1	A	T	9: 24,336,072 (GRCm39)	F545I	probably benign	Het
Dpy19l4	A	G	4: 11,287,643 (GRCm39)		probably benign	Het
Dsg4	A	T	18: 20,599,540 (GRCm39)	T719S	possibly damaging	Het
Efcab7	A	T	4: 99,735,452 (GRCm39)	R159*	probably null	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Fbxw20	A	G	9: 109,052,550 (GRCm39)	V261A	probably damaging	Het
Gtf3c3	C	T	1: 54,456,937 (GRCm39)	A488T	probably damaging	Het
Inpp5j	C	A	11: 3,444,814 (GRCm39)	R953L	possibly damaging	Het
Itprid2	A	G	2: 79,487,873 (GRCm39)	E652G	probably damaging	Het
Lrrk2	C	T	15: 91,584,671 (GRCm39)	R363*	probably null	Het
Ltbp1	A	G	17: 75,667,770 (GRCm39)	D1089G	probably benign	Het
Luc7l	T	C	17: 26,494,832 (GRCm39)		probably benign	Het
Mdn1	G	A	4: 32,746,568 (GRCm39)		probably null	Het
Mgat4a	A	T	1: 37,503,487 (GRCm39)		probably benign	Het
Mmp12	A	G	9: 7,358,289 (GRCm39)	T392A	possibly damaging	Het
Nlrp12	A	G	7: 3,277,166 (GRCm39)	V921A	probably benign	Het
Or5m5	A	T	2: 85,814,651 (GRCm39)	I156F	probably benign	Het
Or5t7	G	A	2: 86,507,629 (GRCm39)	T16I	possibly damaging	Het
Or6c8b	T	A	10: 128,882,711 (GRCm39)	I74F	possibly damaging	Het
Pkd2l1	T	C	19: 44,179,983 (GRCm39)		probably benign	Het
Pramel24	A	G	4: 143,453,425 (GRCm39)	I178V	probably benign	Het
Rictor	C	A	15: 6,823,486 (GRCm39)	C1554*	probably null	Het
Ryr2	A	G	13: 11,960,867 (GRCm39)	C24R	probably damaging	Het
Scamp2	T	A	9: 57,488,863 (GRCm39)	I188N	probably damaging	Het
Smg1	A	T	7: 117,759,013 (GRCm39)		probably benign	Het
Sned1	G	A	1: 93,209,376 (GRCm39)	V830M	possibly damaging	Het
Synrg	C	A	11: 83,914,262 (GRCm39)		probably benign	Het
Syt9	G	T	7: 107,024,562 (GRCm39)	V152F	possibly damaging	Het
Trmt2a	A	G	16: 18,068,304 (GRCm39)		probably benign	Het
Vmn2r100	T	C	17: 19,752,261 (GRCm39)	I831T	probably damaging	Het
Vps13a	G	T	19: 16,727,515 (GRCm39)	H196N	probably benign	Het
Xdh	T	C	17: 74,248,144 (GRCm39)		probably benign	Het

Other mutations in Dusp12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01104:Dusp12	APN	1	170,702,042 (GRCm39)	missense	probably damaging	1.00
IGL02718:Dusp12	APN	1	170,708,226 (GRCm39)	missense	probably damaging	1.00
P0028:Dusp12	UTSW	1	170,707,386 (GRCm39)	nonsense	probably null
R0040:Dusp12	UTSW	1	170,708,226 (GRCm39)	missense	probably damaging	1.00
R0040:Dusp12	UTSW	1	170,708,226 (GRCm39)	missense	probably damaging	1.00
R1833:Dusp12	UTSW	1	170,702,022 (GRCm39)	missense	probably benign
R1850:Dusp12	UTSW	1	170,708,198 (GRCm39)	missense	probably benign	0.12
R2138:Dusp12	UTSW	1	170,708,166 (GRCm39)	nonsense	probably null
R2260:Dusp12	UTSW	1	170,708,580 (GRCm39)	missense	probably damaging	1.00
R3972:Dusp12	UTSW	1	170,707,344 (GRCm39)	missense	probably damaging	0.98
R4298:Dusp12	UTSW	1	170,708,198 (GRCm39)	missense	probably benign	0.12
R4803:Dusp12	UTSW	1	170,708,175 (GRCm39)	missense	possibly damaging	0.51
R6639:Dusp12	UTSW	1	170,708,243 (GRCm39)	missense	probably damaging	1.00
R6674:Dusp12	UTSW	1	170,707,317 (GRCm39)	missense	probably benign	0.13
R6981:Dusp12	UTSW	1	170,708,530 (GRCm39)	missense	probably damaging	1.00
R7432:Dusp12	UTSW	1	170,707,345 (GRCm39)	nonsense	probably null
R7861:Dusp12	UTSW	1	170,702,095 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCACTGGACGTATCGACTTCGTATC -3'
(R):5'- AAATGAGCTGGGCACACTGCAC -3'

Sequencing Primer
(F):5'- Gacacacaccatacacacatac -3'
(R):5'- tgtgtagccctggtcactc -3'

Posted On

2014-01-05