Incidental Mutation 'R1114:1700128F08Rik'
List [record 1 of 1920] next >> last >|
ID97045
Institutional Source Beutler Lab
Gene Symbol 1700128F08Rik
Ensembl Gene ENSMUSG00000031998
Gene NameRIKEN cDNA 1700128F08 gene
Synonyms
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location8221889-8241987 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 8222178 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213708
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Synrg C A 11: 84,023,436 probably benign Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in 1700128F08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0472:1700128F08Rik UTSW 9 8222122 exon noncoding transcript
R4732:1700128F08Rik UTSW 9 8222173 exon noncoding transcript
R4733:1700128F08Rik UTSW 9 8222173 exon noncoding transcript
R4970:1700128F08Rik UTSW 9 8222065 exon noncoding transcript
R5692:1700128F08Rik UTSW 9 8221990 exon noncoding transcript
R5699:1700128F08Rik UTSW 9 8225319 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCGATGGTACAGACGAAGACCCAC -3'
(R):5'- TTCGGAAAAGCCAATCTCGCCC -3'

Sequencing Primer
(F):5'- ACATGACCGAGCTGTGTG -3'
(R):5'- GAACCTCAGTTGCCCAGATTC -3'
Posted On2014-01-05