Incidental Mutation 'R1114:Synrg'
ID97065
Institutional Source Beutler Lab
Gene Symbol Synrg
Ensembl Gene ENSMUSG00000034940
Gene Namesynergin, gamma
SynonymsAp1gbp1, L71-5
MMRRC Submission 039187-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1114 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83964428-84044578 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 84023436 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049714] [ENSMUST00000092834] [ENSMUST00000183456] [ENSMUST00000183714]
Predicted Effect probably benign
Transcript: ENSMUST00000049714
SMART Domains Protein: ENSMUSP00000059000
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
coiled coil region 113 153 N/A INTRINSIC
Blast:EH 301 368 8e-6 BLAST
low complexity region 560 569 N/A INTRINSIC
low complexity region 644 662 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1295 1306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092834
SMART Domains Protein: ENSMUSP00000090510
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 222 289 5e-6 BLAST
low complexity region 481 490 N/A INTRINSIC
low complexity region 565 583 N/A INTRINSIC
internal_repeat_1 617 755 7.57e-6 PROSPERO
internal_repeat_1 746 879 7.57e-6 PROSPERO
low complexity region 880 894 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132887
Predicted Effect probably benign
Transcript: ENSMUST00000183456
SMART Domains Protein: ENSMUSP00000138969
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
Blast:EH 401 468 7e-6 BLAST
low complexity region 660 669 N/A INTRINSIC
low complexity region 744 762 N/A INTRINSIC
internal_repeat_1 796 934 2.26e-5 PROSPERO
internal_repeat_1 925 1058 2.26e-5 PROSPERO
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183714
SMART Domains Protein: ENSMUSP00000139103
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 300 367 6e-6 BLAST
low complexity region 559 568 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
internal_repeat_1 695 833 1.34e-5 PROSPERO
internal_repeat_1 824 957 1.34e-5 PROSPERO
low complexity region 958 972 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184239
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.5%
  • 20x: 84.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the gamma subunit of AP1 clathrin-adaptor complex. The AP1 complex is located at the trans-Golgi network and associates specific proteins with clathrin-coated vesicles. This encoded protein may act to connect the AP1 complex to other proteins. Alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,178 noncoding transcript Het
Acss3 T A 10: 106,988,879 R422S possibly damaging Het
Asb15 G A 6: 24,567,177 R499H probably damaging Het
Aspm C T 1: 139,461,924 probably benign Het
Camk2d G A 3: 126,840,292 V488M probably damaging Het
Cd247 A G 1: 165,788,838 K4E probably benign Het
Cdh20 A G 1: 104,979,014 D522G probably damaging Het
Cse1l T A 2: 166,941,203 probably benign Het
Dctn2 T A 10: 127,278,142 probably null Het
Dpy19l1 A T 9: 24,424,776 F545I probably benign Het
Dpy19l4 A G 4: 11,287,643 probably benign Het
Dsg4 A T 18: 20,466,483 T719S possibly damaging Het
Dusp12 A C 1: 170,881,017 V48G probably damaging Het
Efcab7 A T 4: 99,878,250 R159* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw20 A G 9: 109,223,482 V261A probably damaging Het
Gm13078 A G 4: 143,726,855 I178V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Inpp5j C A 11: 3,494,814 R953L possibly damaging Het
Lrrk2 C T 15: 91,700,468 R363* probably null Het
Ltbp1 A G 17: 75,360,775 D1089G probably benign Het
Luc7l T C 17: 26,275,858 probably benign Het
Mdn1 G A 4: 32,746,568 probably null Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp12 A G 9: 7,358,289 T392A possibly damaging Het
Nlrp12 A G 7: 3,228,534 V921A probably benign Het
Olfr1030 A T 2: 85,984,307 I156F probably benign Het
Olfr1086 G A 2: 86,677,285 T16I possibly damaging Het
Olfr765 T A 10: 129,046,842 I74F possibly damaging Het
Pkd2l1 T C 19: 44,191,544 probably benign Het
Rictor C A 15: 6,794,005 C1554* probably null Het
Ryr2 A G 13: 11,945,981 C24R probably damaging Het
Scamp2 T A 9: 57,581,580 I188N probably damaging Het
Smg1 A T 7: 118,159,790 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssfa2 A G 2: 79,657,529 E652G probably damaging Het
Syt9 G T 7: 107,425,355 V152F possibly damaging Het
Trmt2a A G 16: 18,250,440 probably benign Het
Vmn2r100 T C 17: 19,531,999 I831T probably damaging Het
Vps13a G T 19: 16,750,151 H196N probably benign Het
Xdh T C 17: 73,941,149 probably benign Het
Other mutations in Synrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Synrg APN 11 84039246 missense probably damaging 0.98
IGL01640:Synrg APN 11 83981508 missense probably damaging 1.00
IGL01936:Synrg APN 11 84019705 missense probably benign 0.00
IGL02311:Synrg APN 11 84019804 missense probably benign 0.01
IGL02836:Synrg APN 11 84001978 splice site probably benign
IGL02868:Synrg APN 11 83987050 splice site probably benign
IGL03185:Synrg APN 11 83981479 missense probably damaging 1.00
IGL03224:Synrg APN 11 84039666 missense possibly damaging 0.86
polaris UTSW 11 84019914 missense probably damaging 1.00
P0041:Synrg UTSW 11 83982311 splice site probably benign
R0023:Synrg UTSW 11 84008653 missense probably damaging 1.00
R0044:Synrg UTSW 11 84009181 missense probably damaging 1.00
R0082:Synrg UTSW 11 83987910 splice site probably benign
R0227:Synrg UTSW 11 84009432 missense probably damaging 1.00
R0361:Synrg UTSW 11 84024337 splice site probably null
R0494:Synrg UTSW 11 84019543 missense probably benign
R0548:Synrg UTSW 11 83982188 splice site probably benign
R0744:Synrg UTSW 11 84024305 nonsense probably null
R1240:Synrg UTSW 11 84023356 missense probably damaging 1.00
R1989:Synrg UTSW 11 84019955 critical splice donor site probably null
R2247:Synrg UTSW 11 84009376 missense probably damaging 1.00
R2263:Synrg UTSW 11 83977152 missense possibly damaging 0.79
R2420:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2421:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2937:Synrg UTSW 11 83994354 missense probably damaging 1.00
R3783:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3784:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3785:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3787:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3925:Synrg UTSW 11 84040899 missense probably benign 0.03
R3945:Synrg UTSW 11 84023406 missense probably damaging 1.00
R3950:Synrg UTSW 11 83989815 missense probably damaging 1.00
R5165:Synrg UTSW 11 83990935 missense probably benign 0.02
R5216:Synrg UTSW 11 83982196 missense probably damaging 0.99
R5293:Synrg UTSW 11 83981499 missense probably damaging 1.00
R5561:Synrg UTSW 11 84002240 splice site probably null
R5575:Synrg UTSW 11 84009552 critical splice donor site probably null
R6079:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6085:Synrg UTSW 11 84039661 missense possibly damaging 0.80
R6138:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6259:Synrg UTSW 11 84008658 missense probably damaging 1.00
R6751:Synrg UTSW 11 83981425 missense probably damaging 1.00
R6795:Synrg UTSW 11 84019914 missense probably damaging 1.00
R6944:Synrg UTSW 11 84025086 missense probably damaging 1.00
R7092:Synrg UTSW 11 84008857 missense possibly damaging 0.95
R7109:Synrg UTSW 11 84039672 missense possibly damaging 0.82
R7291:Synrg UTSW 11 84009381 missense probably damaging 1.00
U15987:Synrg UTSW 11 84024300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAACGGAACCTTTGTGTGTACTGTC -3'
(R):5'- GCTTAACTCATTCCACAGGTCACAGC -3'

Sequencing Primer
(F):5'- ACCCAGGATCACACAAGAGG -3'
(R):5'- CAGGGTGTTTAAGATACCACAGAC -3'
Posted On2014-01-05