Incidental Mutation 'R1115:Ift52'
ID97121
Institutional Source Beutler Lab
Gene Symbol Ift52
Ensembl Gene ENSMUSG00000017858
Gene Nameintraflagellar transport 52
SynonymsNGD5
MMRRC Submission 039188-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1115 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location163017354-163046141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163029782 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 178 (K178R)
Ref Sequence ENSEMBL: ENSMUSP00000121943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018002] [ENSMUST00000150396]
Predicted Effect probably benign
Transcript: ENSMUST00000018002
AA Change: K178R

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000018002
Gene: ENSMUSG00000017858
AA Change: K178R

DomainStartEndE-ValueType
Pfam:ABC_transp_aux 1 116 1.8e-13 PFAM
low complexity region 340 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150396
AA Change: K178R

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121943
Gene: ENSMUSG00000017858
AA Change: K178R

DomainStartEndE-ValueType
Pfam:ABC_transp_aux 3 117 4.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152201
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved proline-rich protein that is a component of the intraflagellar transport-B (IFT-B) core complex. The encoded protein is essential for the integrity of the IFT-B core complex, and for biosynthesis and maintenance of cilia. Mutations in this gene are associated with ciliopathy that affects the skeleton. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality between E9 and E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C A 11: 100,479,255 V994F probably damaging Het
Arfgap3 T C 15: 83,330,540 T182A probably benign Het
Bcl2l14 T C 6: 134,432,139 probably benign Het
Cabin1 T C 10: 75,717,677 M1183V possibly damaging Het
Ccr7 A T 11: 99,145,277 I273K possibly damaging Het
Cd40 A G 2: 165,070,761 M211V possibly damaging Het
Coro2b T G 9: 62,431,327 E208A probably damaging Het
Dennd5a A C 7: 109,918,761 M556R probably damaging Het
Efcab2 A T 1: 178,437,497 probably benign Het
Fam160a1 T C 3: 85,722,495 E263G probably benign Het
Fastkd2 T C 1: 63,747,955 probably benign Het
Fbxw8 A C 5: 118,077,571 probably benign Het
Frem1 T C 4: 83,020,770 D25G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kit T C 5: 75,649,532 probably benign Het
Map1a T C 2: 121,307,378 probably null Het
Mxra7 G T 11: 116,810,870 probably benign Het
Myt1 C A 2: 181,811,231 S7* probably null Het
Nphs1 C T 7: 30,481,378 probably benign Het
Olfr355 C A 2: 36,927,502 G204V possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Osgin2 A T 4: 15,998,085 D512E possibly damaging Het
Pde4b T A 4: 102,542,155 probably benign Het
Rasef G T 4: 73,748,604 T146K possibly damaging Het
Ren1 T A 1: 133,356,518 V207D probably damaging Het
S100a8 A G 3: 90,669,873 D59G probably damaging Het
Sdcbp G A 4: 6,377,143 probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Slamf7 A T 1: 171,639,183 D151E probably benign Het
Slco1b2 A G 6: 141,683,254 M561V probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stard9 T C 2: 120,692,850 I662T probably benign Het
Vwf T A 6: 125,655,065 V20D unknown Het
Znhit6 G T 3: 145,594,685 probably null Het
Other mutations in Ift52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02006:Ift52 APN 2 163023369 missense probably benign 0.00
IGL02164:Ift52 APN 2 163025464 splice site probably null
IGL02657:Ift52 APN 2 163045215 missense probably damaging 1.00
IGL02876:Ift52 APN 2 163036707 missense probably benign 0.01
IGL03136:Ift52 APN 2 163025334 nonsense probably null
IGL03292:Ift52 APN 2 163023400 missense probably damaging 1.00
R1502:Ift52 UTSW 2 163029862 critical splice donor site probably null
R1775:Ift52 UTSW 2 163025355 missense possibly damaging 0.79
R2204:Ift52 UTSW 2 163031230 missense probably benign 0.07
R2259:Ift52 UTSW 2 163028093 missense probably benign 0.04
R2348:Ift52 UTSW 2 163045257 missense probably damaging 0.99
R4820:Ift52 UTSW 2 163031188 missense probably benign 0.06
R5464:Ift52 UTSW 2 163029815 missense probably benign 0.20
R7054:Ift52 UTSW 2 163029796 missense probably damaging 0.98
Z1088:Ift52 UTSW 2 163023358 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCCGTAGACACATGCACACTAGCATA -3'
(R):5'- TGCAGCCAAAgctggagagaga -3'

Sequencing Primer
(F):5'- actaagttctctcctgctgctg -3'
(R):5'- tccaacttcctctaccccc -3'
Posted On2014-01-05