Incidental Mutation 'R1115:Cd40'
ID 97123
Institutional Source Beutler Lab
Gene Symbol Cd40
Ensembl Gene ENSMUSG00000017652
Gene Name CD40 antigen
Synonyms Tnfrsf5, p50, Bp50, Cd40
MMRRC Submission 039188-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1115 (G1)
Quality Score 173
Status Validated
Chromosome 2
Chromosomal Location 164897535-164913574 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 164912681 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 211 (M211V)
Ref Sequence ENSEMBL: ENSMUSP00000073386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017799] [ENSMUST00000073707] [ENSMUST00000081310] [ENSMUST00000184221]
AlphaFold P27512
Predicted Effect probably benign
Transcript: ENSMUST00000017799
AA Change: M240V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017799
Gene: ENSMUSG00000017652
AA Change: M240V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000073707
AA Change: M211V

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073386
Gene: ENSMUSG00000017652
AA Change: M211V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081310
SMART Domains Protein: ENSMUSP00000080059
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153105
Predicted Effect probably benign
Transcript: ENSMUST00000184221
SMART Domains Protein: ENSMUSP00000139193
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene may cause impaired immunoglobulin class switching and germinal center formation, reduced susceptibility to type II hypersensitivity reaction, impaired priming of T cells and control of M. tuberculosis infection, and altered response to transplant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C A 11: 100,370,081 (GRCm39) V994F probably damaging Het
Arfgap3 T C 15: 83,214,741 (GRCm39) T182A probably benign Het
Bcl2l14 T C 6: 134,409,102 (GRCm39) probably benign Het
Cabin1 T C 10: 75,553,511 (GRCm39) M1183V possibly damaging Het
Ccr7 A T 11: 99,036,103 (GRCm39) I273K possibly damaging Het
Coro2b T G 9: 62,338,609 (GRCm39) E208A probably damaging Het
Dennd5a A C 7: 109,517,968 (GRCm39) M556R probably damaging Het
Efcab2 A T 1: 178,265,062 (GRCm39) probably benign Het
Fastkd2 T C 1: 63,787,114 (GRCm39) probably benign Het
Fbxw8 A C 5: 118,215,636 (GRCm39) probably benign Het
Fhip1a T C 3: 85,629,802 (GRCm39) E263G probably benign Het
Frem1 T C 4: 82,939,007 (GRCm39) D25G probably benign Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Ift52 A G 2: 162,871,702 (GRCm39) K178R probably benign Het
Kit T C 5: 75,810,192 (GRCm39) probably benign Het
Map1a T C 2: 121,137,859 (GRCm39) probably null Het
Mxra7 G T 11: 116,701,696 (GRCm39) probably benign Het
Myt1 C A 2: 181,453,024 (GRCm39) S7* probably null Het
Nphs1 C T 7: 30,180,803 (GRCm39) probably benign Het
Or10h28 C T 17: 33,487,940 (GRCm39) R81* probably null Het
Or1l8 C A 2: 36,817,514 (GRCm39) G204V possibly damaging Het
Osgin2 A T 4: 15,998,085 (GRCm39) D512E possibly damaging Het
Pde4b T A 4: 102,399,352 (GRCm39) probably benign Het
Rasef G T 4: 73,666,841 (GRCm39) T146K possibly damaging Het
Ren1 T A 1: 133,284,256 (GRCm39) V207D probably damaging Het
S100a8 A G 3: 90,577,180 (GRCm39) D59G probably damaging Het
Sdcbp G A 4: 6,377,143 (GRCm39) probably null Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Slamf7 A T 1: 171,466,751 (GRCm39) D151E probably benign Het
Slco1b2 A G 6: 141,628,980 (GRCm39) M561V probably benign Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Stard9 T C 2: 120,523,331 (GRCm39) I662T probably benign Het
Vwf T A 6: 125,632,028 (GRCm39) V20D unknown Het
Znhit6 G T 3: 145,300,440 (GRCm39) probably null Het
Other mutations in Cd40
AlleleSourceChrCoordTypePredicted EffectPPH Score
bluebonnet UTSW 2 164,904,221 (GRCm39) missense probably benign 0.23
noelle UTSW 2 164,905,483 (GRCm39) critical splice donor site probably null
R0553:Cd40 UTSW 2 164,912,661 (GRCm39) missense probably benign 0.01
R1134:Cd40 UTSW 2 164,912,738 (GRCm39) missense probably benign 0.44
R2036:Cd40 UTSW 2 164,904,221 (GRCm39) missense probably benign 0.23
R2938:Cd40 UTSW 2 164,911,622 (GRCm39) missense probably benign 0.01
R3034:Cd40 UTSW 2 164,904,235 (GRCm39) missense probably benign 0.02
R4690:Cd40 UTSW 2 164,911,615 (GRCm39) missense possibly damaging 0.68
R5222:Cd40 UTSW 2 164,908,464 (GRCm39) missense probably benign 0.41
R5310:Cd40 UTSW 2 164,905,483 (GRCm39) critical splice donor site probably null
R7318:Cd40 UTSW 2 164,904,255 (GRCm39) missense possibly damaging 0.51
R7833:Cd40 UTSW 2 164,908,431 (GRCm39) missense probably benign 0.01
R7905:Cd40 UTSW 2 164,904,245 (GRCm39) missense probably damaging 1.00
R8069:Cd40 UTSW 2 164,898,695 (GRCm39) missense unknown
R8371:Cd40 UTSW 2 164,908,458 (GRCm39) missense probably damaging 1.00
R9177:Cd40 UTSW 2 164,905,465 (GRCm39) missense probably damaging 1.00
R9224:Cd40 UTSW 2 164,898,716 (GRCm39) missense unknown
R9311:Cd40 UTSW 2 164,912,667 (GRCm39) missense possibly damaging 0.87
R9419:Cd40 UTSW 2 164,904,162 (GRCm39) intron probably benign
R9625:Cd40 UTSW 2 164,905,061 (GRCm39) missense probably benign
Z1088:Cd40 UTSW 2 164,904,960 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCAAATTTCATGTGTCCAGCAGG -3'
(R):5'- ACTTCAAAGGTCAGCAAGCAGTCC -3'

Sequencing Primer
(F):5'- GCAGAAGGCATCCAAGAAATC -3'
(R):5'- GTCAGCAAGCAGTCCTCAGAG -3'
Posted On 2014-01-05