Incidental Mutation 'R1115:Rasef'
ID 97143
Institutional Source Beutler Lab
Gene Symbol Rasef
Ensembl Gene ENSMUSG00000043003
Gene Name RAS and EF hand domain containing
Synonyms RAB45
MMRRC Submission 039188-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R1115 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 73632816-73709231 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 73666841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 146 (T146K)
Ref Sequence ENSEMBL: ENSMUSP00000099901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]
AlphaFold Q5RI75
Predicted Effect possibly damaging
Transcript: ENSMUST00000058292
AA Change: T218K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: T218K

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
coiled coil region 55 251 N/A INTRINSIC
RAB 429 598 4.94e-69 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102837
AA Change: T146K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: T146K

DomainStartEndE-ValueType
coiled coil region 5 179 N/A INTRINSIC
RAB 357 526 4.94e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222414
AA Change: T299K

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C A 11: 100,370,081 (GRCm39) V994F probably damaging Het
Arfgap3 T C 15: 83,214,741 (GRCm39) T182A probably benign Het
Bcl2l14 T C 6: 134,409,102 (GRCm39) probably benign Het
Cabin1 T C 10: 75,553,511 (GRCm39) M1183V possibly damaging Het
Ccr7 A T 11: 99,036,103 (GRCm39) I273K possibly damaging Het
Cd40 A G 2: 164,912,681 (GRCm39) M211V possibly damaging Het
Coro2b T G 9: 62,338,609 (GRCm39) E208A probably damaging Het
Dennd5a A C 7: 109,517,968 (GRCm39) M556R probably damaging Het
Efcab2 A T 1: 178,265,062 (GRCm39) probably benign Het
Fastkd2 T C 1: 63,787,114 (GRCm39) probably benign Het
Fbxw8 A C 5: 118,215,636 (GRCm39) probably benign Het
Fhip1a T C 3: 85,629,802 (GRCm39) E263G probably benign Het
Frem1 T C 4: 82,939,007 (GRCm39) D25G probably benign Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Ift52 A G 2: 162,871,702 (GRCm39) K178R probably benign Het
Kit T C 5: 75,810,192 (GRCm39) probably benign Het
Map1a T C 2: 121,137,859 (GRCm39) probably null Het
Mxra7 G T 11: 116,701,696 (GRCm39) probably benign Het
Myt1 C A 2: 181,453,024 (GRCm39) S7* probably null Het
Nphs1 C T 7: 30,180,803 (GRCm39) probably benign Het
Or10h28 C T 17: 33,487,940 (GRCm39) R81* probably null Het
Or1l8 C A 2: 36,817,514 (GRCm39) G204V possibly damaging Het
Osgin2 A T 4: 15,998,085 (GRCm39) D512E possibly damaging Het
Pde4b T A 4: 102,399,352 (GRCm39) probably benign Het
Ren1 T A 1: 133,284,256 (GRCm39) V207D probably damaging Het
S100a8 A G 3: 90,577,180 (GRCm39) D59G probably damaging Het
Sdcbp G A 4: 6,377,143 (GRCm39) probably null Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Slamf7 A T 1: 171,466,751 (GRCm39) D151E probably benign Het
Slco1b2 A G 6: 141,628,980 (GRCm39) M561V probably benign Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Stard9 T C 2: 120,523,331 (GRCm39) I662T probably benign Het
Vwf T A 6: 125,632,028 (GRCm39) V20D unknown Het
Znhit6 G T 3: 145,300,440 (GRCm39) probably null Het
Other mutations in Rasef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Rasef APN 4 73,689,662 (GRCm39) nonsense probably null
IGL01329:Rasef APN 4 73,645,882 (GRCm39) missense probably damaging 1.00
IGL01517:Rasef APN 4 73,688,059 (GRCm39) missense probably benign 0.03
IGL02465:Rasef APN 4 73,652,725 (GRCm39) missense probably damaging 1.00
IGL02676:Rasef APN 4 73,677,966 (GRCm39) missense possibly damaging 0.69
IGL03137:Rasef APN 4 73,652,720 (GRCm39) nonsense probably null
IGL03403:Rasef APN 4 73,652,771 (GRCm39) missense probably damaging 1.00
BB001:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
BB011:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
P0033:Rasef UTSW 4 73,668,089 (GRCm39) missense probably benign 0.26
R0035:Rasef UTSW 4 73,681,091 (GRCm39) splice site probably benign
R0035:Rasef UTSW 4 73,681,091 (GRCm39) splice site probably benign
R0317:Rasef UTSW 4 73,666,799 (GRCm39) missense probably damaging 1.00
R0686:Rasef UTSW 4 73,652,771 (GRCm39) missense probably damaging 1.00
R0987:Rasef UTSW 4 73,652,721 (GRCm39) nonsense probably null
R1511:Rasef UTSW 4 73,653,985 (GRCm39) missense probably damaging 1.00
R1585:Rasef UTSW 4 73,658,574 (GRCm39) missense probably damaging 1.00
R1646:Rasef UTSW 4 73,652,786 (GRCm39) missense probably damaging 1.00
R1705:Rasef UTSW 4 73,662,301 (GRCm39) nonsense probably null
R1918:Rasef UTSW 4 73,662,351 (GRCm39) missense possibly damaging 0.94
R1919:Rasef UTSW 4 73,662,351 (GRCm39) missense possibly damaging 0.94
R3819:Rasef UTSW 4 73,677,942 (GRCm39) missense probably damaging 1.00
R3891:Rasef UTSW 4 73,698,634 (GRCm39) missense probably benign 0.03
R3892:Rasef UTSW 4 73,698,634 (GRCm39) missense probably benign 0.03
R4344:Rasef UTSW 4 73,663,326 (GRCm39) missense probably damaging 1.00
R4491:Rasef UTSW 4 73,652,740 (GRCm39) missense probably damaging 1.00
R4492:Rasef UTSW 4 73,652,740 (GRCm39) missense probably damaging 1.00
R4594:Rasef UTSW 4 73,698,626 (GRCm39) missense possibly damaging 0.47
R4915:Rasef UTSW 4 73,649,696 (GRCm39) missense probably damaging 1.00
R5276:Rasef UTSW 4 73,654,004 (GRCm39) missense probably null 1.00
R5359:Rasef UTSW 4 73,689,565 (GRCm39) missense probably damaging 1.00
R5682:Rasef UTSW 4 73,659,208 (GRCm39) nonsense probably null
R5693:Rasef UTSW 4 73,688,076 (GRCm39) missense probably damaging 0.99
R6414:Rasef UTSW 4 73,658,818 (GRCm39) missense probably benign 0.13
R6543:Rasef UTSW 4 73,698,756 (GRCm39) intron probably benign
R6593:Rasef UTSW 4 73,663,327 (GRCm39) missense probably damaging 1.00
R7078:Rasef UTSW 4 73,698,626 (GRCm39) missense probably benign 0.01
R7083:Rasef UTSW 4 73,709,221 (GRCm39) missense probably benign 0.26
R7106:Rasef UTSW 4 73,645,864 (GRCm39) missense probably damaging 1.00
R7127:Rasef UTSW 4 73,662,369 (GRCm39) missense probably damaging 1.00
R7329:Rasef UTSW 4 73,662,374 (GRCm39) missense probably damaging 1.00
R7767:Rasef UTSW 4 73,652,771 (GRCm39) missense probably damaging 1.00
R7891:Rasef UTSW 4 73,709,201 (GRCm39) missense probably benign
R7891:Rasef UTSW 4 73,677,935 (GRCm39) missense probably benign 0.00
R7924:Rasef UTSW 4 73,659,166 (GRCm39) critical splice donor site probably null
R7997:Rasef UTSW 4 73,658,799 (GRCm39) missense possibly damaging 0.78
R8554:Rasef UTSW 4 73,645,844 (GRCm39) missense probably benign 0.03
R8832:Rasef UTSW 4 73,698,558 (GRCm39) intron probably benign
R8850:Rasef UTSW 4 73,645,840 (GRCm39) missense probably damaging 1.00
R8985:Rasef UTSW 4 73,708,960 (GRCm39) missense possibly damaging 0.48
R9093:Rasef UTSW 4 73,698,583 (GRCm39) missense probably benign 0.00
R9179:Rasef UTSW 4 73,662,356 (GRCm39) missense probably damaging 0.97
R9199:Rasef UTSW 4 73,658,625 (GRCm39) missense possibly damaging 0.88
R9300:Rasef UTSW 4 73,659,393 (GRCm39) missense probably benign
R9310:Rasef UTSW 4 73,653,956 (GRCm39) critical splice donor site probably null
R9415:Rasef UTSW 4 73,645,882 (GRCm39) missense probably benign 0.00
R9482:Rasef UTSW 4 73,708,933 (GRCm39) missense probably benign 0.00
R9719:Rasef UTSW 4 73,688,102 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCTGCAATGAGAAGACACAGTGACC -3'
(R):5'- AAGCTCACAGAGAAGAACTGGCTTG -3'

Sequencing Primer
(F):5'- CTAGTGACCTAAACACTGGGC -3'
(R):5'- TTACAGGTATTCTGATAGGGACCAG -3'
Posted On 2014-01-05