Incidental Mutation 'R0981:Ofcc1'
ID97197
Institutional Source Beutler Lab
Gene Symbol Ofcc1
Ensembl Gene ENSMUSG00000047094
Gene Nameorofacial cleft 1 candidate 1
SynonymsOpo, ojoplano
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0981 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location40001882-40361450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40072698 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 786 (I786T)
Ref Sequence ENSEMBL: ENSMUSP00000062217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054635] [ENSMUST00000224909]
Predicted Effect probably damaging
Transcript: ENSMUST00000054635
AA Change: I786T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062217
Gene: ENSMUSG00000047094
AA Change: I786T

DomainStartEndE-ValueType
Pfam:OFCC1 5 113 1.3e-57 PFAM
transmembrane domain 575 592 N/A INTRINSIC
transmembrane domain 599 618 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224909
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal skull morphology and normal behavior with in increase in gamma-glutamyl transpeptidase. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,520,331 C942S probably damaging Het
Alpk1 T C 3: 127,679,402 N984S possibly damaging Het
Ankrd55 T C 13: 112,323,076 V68A possibly damaging Het
Asap2 T C 12: 21,265,960 S960P probably damaging Het
Atp2b1 T A 10: 99,015,629 N66K probably damaging Het
Cckar C T 5: 53,706,290 G39R probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cpb1 C A 3: 20,275,490 R24L probably benign Het
Dlg5 T G 14: 24,154,631 R1258S probably damaging Het
Fam71e2 T A 7: 4,757,589 probably null Het
Fanci A G 7: 79,405,166 Q148R probably benign Het
Fcgbp T A 7: 28,085,110 Y198* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Glis1 A G 4: 107,615,042 E272G probably damaging Het
Gm13741 T C 2: 87,656,234 N229S probably benign Het
Gsdmc4 T A 15: 63,892,073 I392F probably damaging Het
H2-M2 T C 17: 37,482,630 T162A probably benign Het
Hk2 G A 6: 82,743,968 R190W probably damaging Het
Irf1 T C 11: 53,773,722 *52R probably null Het
Lman2l T A 1: 36,445,233 M1L unknown Het
Mgat1 C T 11: 49,261,055 R122C probably damaging Het
Mtrf1 T C 14: 79,401,590 L54S probably benign Het
Myo5c A T 9: 75,271,591 L676F probably damaging Het
Odf3 A G 7: 140,848,295 M7V probably benign Het
Olfr488 AGGT A 7: 108,256,021 probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Pfn1 G A 11: 70,652,138 R137C probably benign Het
Pgbd5 G A 8: 124,384,293 R129* probably null Het
Pibf1 T C 14: 99,150,743 probably null Het
Pkd2l1 A G 19: 44,154,422 probably null Het
Plin5 C A 17: 56,114,020 R215L probably damaging Het
Prrc2c C T 1: 162,705,981 probably benign Het
Rnasel T G 1: 153,759,599 C608G probably benign Het
Slc28a2 T A 2: 122,450,984 V218D probably damaging Het
Snx1 T C 9: 66,109,559 I29V probably benign Het
Tenm3 A G 8: 48,298,965 W939R probably damaging Het
Tmem237 C A 1: 59,118,005 R15L probably damaging Het
Tmx3 T C 18: 90,537,200 V347A probably benign Het
Vmn1r191 T C 13: 22,179,219 T122A probably benign Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Zfp408 A G 2: 91,645,183 L642P probably benign Het
Zfp808 C A 13: 62,171,673 H239N possibly damaging Het
Other mutations in Ofcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Ofcc1 APN 13 40142804 missense probably damaging 0.97
IGL00489:Ofcc1 APN 13 40280491 missense probably damaging 1.00
IGL01952:Ofcc1 APN 13 40280861 missense probably damaging 1.00
IGL02126:Ofcc1 APN 13 40208775 missense probably benign
IGL02619:Ofcc1 APN 13 40097077 missense possibly damaging 0.68
IGL03069:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03133:Ofcc1 APN 13 40072768 missense probably benign 0.36
IGL03273:Ofcc1 APN 13 40180525 missense probably damaging 1.00
IGL03343:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03349:Ofcc1 APN 13 40072752 missense probably benign 0.13
IGL03399:Ofcc1 APN 13 40142838 missense possibly damaging 0.56
LCD18:Ofcc1 UTSW 13 40092967 intron probably benign
R0122:Ofcc1 UTSW 13 40280556 splice site probably null
R0320:Ofcc1 UTSW 13 40206696 missense probably benign 0.01
R0386:Ofcc1 UTSW 13 40214474 nonsense probably null
R0390:Ofcc1 UTSW 13 40015313 missense possibly damaging 0.85
R0829:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0866:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0945:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1055:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1056:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1186:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1187:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1400:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1411:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R1419:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1474:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1636:Ofcc1 UTSW 13 40180428 missense possibly damaging 0.86
R1691:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1886:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R1887:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R2176:Ofcc1 UTSW 13 40097119 missense probably benign
R2189:Ofcc1 UTSW 13 40180448 missense probably benign
R2242:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R2255:Ofcc1 UTSW 13 40094705 missense probably damaging 0.99
R2471:Ofcc1 UTSW 13 40097025 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40072760 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40087938 missense possibly damaging 0.56
R4366:Ofcc1 UTSW 13 40015461 missense probably benign 0.18
R4573:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4574:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4656:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4657:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4673:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4782:Ofcc1 UTSW 13 40001892 synonymous probably null
R4790:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4823:Ofcc1 UTSW 13 40280473 missense probably damaging 0.99
R4834:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4840:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4842:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4889:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4919:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4920:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4921:Ofcc1 UTSW 13 40214517 missense probably benign 0.10
R4948:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4953:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4961:Ofcc1 UTSW 13 40263559 critical splice donor site probably null
R5339:Ofcc1 UTSW 13 40087845 missense probably benign 0.35
R5512:Ofcc1 UTSW 13 40206810 missense probably benign 0.20
R5566:Ofcc1 UTSW 13 40094653 missense probably damaging 1.00
R5672:Ofcc1 UTSW 13 40280429 missense probably damaging 0.98
R5734:Ofcc1 UTSW 13 40087849 missense probably damaging 1.00
R5839:Ofcc1 UTSW 13 40280545 missense probably damaging 1.00
R5853:Ofcc1 UTSW 13 40206717 missense probably benign 0.00
R5896:Ofcc1 UTSW 13 40180584 missense probably benign 0.01
R5909:Ofcc1 UTSW 13 40263578 missense possibly damaging 0.92
R5995:Ofcc1 UTSW 13 40280422 missense probably damaging 1.00
R6306:Ofcc1 UTSW 13 40148576 missense probably benign
R6460:Ofcc1 UTSW 13 40287979 missense probably damaging 0.99
R6504:Ofcc1 UTSW 13 40097055 missense probably damaging 1.00
R6797:Ofcc1 UTSW 13 40087947 missense possibly damaging 0.75
R7091:Ofcc1 UTSW 13 40072767 missense probably damaging 0.99
R7098:Ofcc1 UTSW 13 40003966 critical splice donor site probably null
R7142:Ofcc1 UTSW 13 40004062 missense probably benign 0.00
R7240:Ofcc1 UTSW 13 40208841 missense probably benign
X0005:Ofcc1 UTSW 13 40142790 missense probably benign 0.01
X0005:Ofcc1 UTSW 13 40280532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAACAGCCTGAGCGAATGCAC -3'
(R):5'- GTCTGTTGGGCATCATAAGCTGGTC -3'

Sequencing Primer
(F):5'- TGCACAGCTTACTGATGCAG -3'
(R):5'- CCACAGTGAAGAAGGCAAGTTC -3'
Posted On2014-01-05