Incidental Mutation 'R0981:Pkd2l1'
ID97230
Institutional Source Beutler Lab
Gene Symbol Pkd2l1
Ensembl Gene ENSMUSG00000037578
Gene Namepolycystic kidney disease 2-like 1
SynonymsPCL, PKD2L, Pkdl, polycystin-L, TRPP3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0981 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44147637-44192442 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 44154422 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042026]
Predicted Effect probably null
Transcript: ENSMUST00000042026
SMART Domains Protein: ENSMUSP00000045675
Gene: ENSMUSG00000037578

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
Pfam:PKD_channel 145 567 1.3e-172 PFAM
Pfam:Ion_trans 335 572 1.8e-30 PFAM
low complexity region 592 598 N/A INTRINSIC
SCOP:d2pvba_ 616 676 2e-4 SMART
PDB:4GIF|A 698 739 1e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161357
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased chorda tympani nerve response to sour tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,520,331 C942S probably damaging Het
Alpk1 T C 3: 127,679,402 N984S possibly damaging Het
Ankrd55 T C 13: 112,323,076 V68A possibly damaging Het
Asap2 T C 12: 21,265,960 S960P probably damaging Het
Atp2b1 T A 10: 99,015,629 N66K probably damaging Het
Cckar C T 5: 53,706,290 G39R probably damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Cpb1 C A 3: 20,275,490 R24L probably benign Het
Dlg5 T G 14: 24,154,631 R1258S probably damaging Het
Fam71e2 T A 7: 4,757,589 probably null Het
Fanci A G 7: 79,405,166 Q148R probably benign Het
Fcgbp T A 7: 28,085,110 Y198* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Glis1 A G 4: 107,615,042 E272G probably damaging Het
Gm13741 T C 2: 87,656,234 N229S probably benign Het
Gsdmc4 T A 15: 63,892,073 I392F probably damaging Het
H2-M2 T C 17: 37,482,630 T162A probably benign Het
Hk2 G A 6: 82,743,968 R190W probably damaging Het
Irf1 T C 11: 53,773,722 *52R probably null Het
Lman2l T A 1: 36,445,233 M1L unknown Het
Mgat1 C T 11: 49,261,055 R122C probably damaging Het
Mtrf1 T C 14: 79,401,590 L54S probably benign Het
Myo5c A T 9: 75,271,591 L676F probably damaging Het
Odf3 A G 7: 140,848,295 M7V probably benign Het
Ofcc1 A G 13: 40,072,698 I786T probably damaging Het
Olfr488 AGGT A 7: 108,256,021 probably benign Het
Olfr488 GGTAG GG 7: 108,256,022 probably benign Het
Pfn1 G A 11: 70,652,138 R137C probably benign Het
Pgbd5 G A 8: 124,384,293 R129* probably null Het
Pibf1 T C 14: 99,150,743 probably null Het
Plin5 C A 17: 56,114,020 R215L probably damaging Het
Prrc2c C T 1: 162,705,981 probably benign Het
Rnasel T G 1: 153,759,599 C608G probably benign Het
Slc28a2 T A 2: 122,450,984 V218D probably damaging Het
Snx1 T C 9: 66,109,559 I29V probably benign Het
Tenm3 A G 8: 48,298,965 W939R probably damaging Het
Tmem237 C A 1: 59,118,005 R15L probably damaging Het
Tmx3 T C 18: 90,537,200 V347A probably benign Het
Vmn1r191 T C 13: 22,179,219 T122A probably benign Het
Wdfy4 G T 14: 33,147,092 N326K probably benign Het
Zfp408 A G 2: 91,645,183 L642P probably benign Het
Zfp808 C A 13: 62,171,673 H239N possibly damaging Het
Other mutations in Pkd2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pkd2l1 APN 19 44157636 critical splice donor site probably null
IGL00426:Pkd2l1 APN 19 44155605 missense probably benign 0.21
IGL00848:Pkd2l1 APN 19 44192279 utr 5 prime probably benign
IGL01315:Pkd2l1 APN 19 44192196 missense probably benign 0.09
IGL01654:Pkd2l1 APN 19 44154223 missense probably damaging 0.98
IGL01786:Pkd2l1 APN 19 44191442 missense probably damaging 0.96
IGL02174:Pkd2l1 APN 19 44157268 missense probably benign 0.04
IGL02648:Pkd2l1 APN 19 44155536 missense possibly damaging 0.72
R0654:Pkd2l1 UTSW 19 44157631 splice site probably null
R0762:Pkd2l1 UTSW 19 44150470 missense probably benign 0.19
R1114:Pkd2l1 UTSW 19 44191544 splice site probably benign
R1381:Pkd2l1 UTSW 19 44150463 missense probably benign 0.08
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1754:Pkd2l1 UTSW 19 44155601 nonsense probably null
R2009:Pkd2l1 UTSW 19 44155964 missense probably benign 0.01
R2125:Pkd2l1 UTSW 19 44154500 missense possibly damaging 0.91
R2696:Pkd2l1 UTSW 19 44157269 missense probably benign 0.01
R3001:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3002:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3701:Pkd2l1 UTSW 19 44157227 missense probably damaging 0.99
R4179:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4180:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4614:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4616:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4617:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4618:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4762:Pkd2l1 UTSW 19 44155621 missense probably benign 0.09
R4893:Pkd2l1 UTSW 19 44153771 missense probably benign 0.00
R4907:Pkd2l1 UTSW 19 44154142 missense possibly damaging 0.95
R5004:Pkd2l1 UTSW 19 44149577 missense probably benign 0.00
R5380:Pkd2l1 UTSW 19 44157732 missense probably benign 0.33
R5480:Pkd2l1 UTSW 19 44192156 missense probably benign 0.18
R5950:Pkd2l1 UTSW 19 44152090 missense probably benign 0.27
R6248:Pkd2l1 UTSW 19 44157669 missense probably benign 0.00
R6908:Pkd2l1 UTSW 19 44152446 missense probably damaging 1.00
R6925:Pkd2l1 UTSW 19 44191508 missense possibly damaging 0.92
R7021:Pkd2l1 UTSW 19 44154208 missense probably damaging 0.98
R7322:Pkd2l1 UTSW 19 44157690 missense probably benign 0.00
R7378:Pkd2l1 UTSW 19 44153715 missense probably benign 0.05
R7442:Pkd2l1 UTSW 19 44157229 missense probably benign 0.01
X0026:Pkd2l1 UTSW 19 44157182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCAGGTGGGGAAATTACTCG -3'
(R):5'- CCACATATTCCGAACCCTGGAAGTG -3'

Sequencing Primer
(F):5'- cacttgggtcccaaaaagc -3'
(R):5'- CCTGGAAGTGAACCGACTG -3'
Posted On2014-01-05