Incidental Mutation 'R0987:Kirrel2'
ID97278
Institutional Source Beutler Lab
Gene Symbol Kirrel2
Ensembl Gene ENSMUSG00000036915
Gene Namekirre like nephrin family adhesion molecule 2
SynonymsC330019F22Rik, NEPH3
MMRRC Submission 039107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R0987 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30447534-30457690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30448130 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 698 (T698A)
Ref Sequence ENSEMBL: ENSMUSP00000039395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006828] [ENSMUST00000045817]
Predicted Effect probably benign
Transcript: ENSMUST00000006828
SMART Domains Protein: ENSMUSP00000006828
Gene: ENSMUSG00000006651

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
A4_EXTRA 46 211 1.72e-114 SMART
low complexity region 234 247 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
Pfam:APP_E2 289 471 9.3e-72 PFAM
Pfam:APP_amyloid 600 651 9.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000045817
AA Change: T698A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039395
Gene: ENSMUSG00000036915
AA Change: T698A

DomainStartEndE-ValueType
IG 27 117 9.18e-12 SMART
IG 128 219 5.13e-1 SMART
IG_like 230 306 8.06e0 SMART
IGc2 321 379 3.06e-8 SMART
IG_like 401 500 4.65e1 SMART
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 547 565 N/A INTRINSIC
low complexity region 607 629 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140565
Predicted Effect unknown
Transcript: ENSMUST00000170152
AA Change: T172A
SMART Domains Protein: ENSMUSP00000132652
Gene: ENSMUSG00000036915
AA Change: T172A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209054
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane protein and member of the immunoglobulin superfamily of cell adhesion molecules. The encoded protein localizes to adherens junctions in pancreatic beta cells and regulates insulin secretion. Autoantibodies against the encoded protein have been detected in serum from patients with type 1 diabetes. This gene may also play a role in glomerular development and decreased expression of this gene has been observed in human glomerular diseases. This gene and the related opposite-strand gene nephrin (GeneID: 527362) are regulated by a bidirectional promoter. [provided by RefSeq, Jul 2016]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,519,932 V16D possibly damaging Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Car6 A G 4: 150,197,343 I71T probably damaging Het
Crem A T 18: 3,288,060 S178T probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fcgbp G T 7: 28,094,174 C1167F probably damaging Het
Glipr1l1 A G 10: 112,078,435 S234G probably benign Het
Igsf9b T C 9: 27,332,553 probably null Het
Kif26b T C 1: 178,821,620 L435P probably damaging Het
Lrrc9 T C 12: 72,510,382 V1407A probably benign Het
Mau2 T C 8: 70,027,698 D275G probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Notch2 T C 3: 98,134,677 probably null Het
Nr0b2 G A 4: 133,556,192 V247I probably benign Het
Olfr1066 A T 2: 86,455,547 C241* probably null Het
Olfr1156 G A 2: 87,949,547 R229C probably benign Het
Olfr1206 A T 2: 88,865,183 I193L probably benign Het
Pigf A G 17: 86,997,545 L190P probably damaging Het
Rasef A T 4: 73,734,484 C593* probably null Het
Tex15 T G 8: 33,576,847 W2102G probably damaging Het
Tmbim1 T C 1: 74,293,924 probably null Het
Tmem183a A T 1: 134,352,371 F257Y probably damaging Het
Zbtb11 A G 16: 55,990,708 T410A probably benign Het
Zzef1 TGCGTGGGAACCCGC TGC 11: 72,901,333 probably benign Het
Other mutations in Kirrel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Kirrel2 APN 7 30453664 missense probably benign 0.03
IGL02457:Kirrel2 APN 7 30452740 missense probably damaging 1.00
IGL02609:Kirrel2 APN 7 30448340 missense probably benign 0.00
R0029:Kirrel2 UTSW 7 30453165 unclassified probably benign
R0395:Kirrel2 UTSW 7 30450458 missense possibly damaging 0.68
R1511:Kirrel2 UTSW 7 30456498 missense probably damaging 1.00
R2226:Kirrel2 UTSW 7 30454154 missense probably damaging 1.00
R4818:Kirrel2 UTSW 7 30449868 missense probably benign 0.32
R4963:Kirrel2 UTSW 7 30450801 critical splice donor site probably null
R6918:Kirrel2 UTSW 7 30450814 missense probably damaging 1.00
R6985:Kirrel2 UTSW 7 30455306 missense probably damaging 1.00
R6995:Kirrel2 UTSW 7 30455179 missense probably damaging 1.00
R7014:Kirrel2 UTSW 7 30454574 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGCGGCCATATTGCTCCCAC -3'
(R):5'- AGCCACATCTGGACTTAGTCCCTC -3'

Sequencing Primer
(F):5'- ACTTGGAGAATCCACTTTGGC -3'
(R):5'- GGACTTAGTCCCTCCCTGC -3'
Posted On2014-01-05