Incidental Mutation 'R0988:Krtap4-9'
ID97407
Institutional Source Beutler Lab
Gene Symbol Krtap4-9
Ensembl Gene ENSMUSG00000078262
Gene Namekeratin associated protein 4-9
SynonymsOTTMUSG00000002198
MMRRC Submission 039108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0988 (G1)
Quality Score105
Status Validated
Chromosome11
Chromosomal Location99785200-99786258 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 99785536 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 94 (C94*)
Ref Sequence ENSEMBL: ENSMUSP00000100680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105059] [ENSMUST00000107439]
Predicted Effect probably null
Transcript: ENSMUST00000105059
AA Change: C94*
SMART Domains Protein: ENSMUSP00000100680
Gene: ENSMUSG00000078262
AA Change: C94*

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 1.2e-8 PFAM
Pfam:Keratin_B2_2 14 58 4.4e-13 PFAM
Pfam:Keratin_B2_2 54 102 3e-10 PFAM
Pfam:Keratin_B2_2 87 132 8.4e-12 PFAM
Pfam:Keratin_B2_2 98 147 3.4e-9 PFAM
Pfam:Keratin_B2_2 138 182 3.1e-12 PFAM
Pfam:Keratin_B2_2 178 222 4.8e-12 PFAM
Pfam:Keratin_B2_2 203 244 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107439
SMART Domains Protein: ENSMUSP00000103063
Gene: ENSMUSG00000089724

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 14 58 1.8e-13 PFAM
Pfam:Keratin_B2_2 54 98 6.7e-15 PFAM
Pfam:Keratin_B2_2 94 138 9.5e-15 PFAM
Pfam:Keratin_B2_2 138 182 1.5e-12 PFAM
Pfam:Keratin_B2_2 168 209 8.2e-9 PFAM
Meta Mutation Damage Score 0.6272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,932,575 I340V probably benign Het
Ano1 T G 7: 144,633,653 S459R possibly damaging Het
Cop1 T C 1: 159,232,847 V67A possibly damaging Het
Cop1 A G 1: 159,244,672 Y186C probably damaging Het
Cst11 G A 2: 148,770,426 T97I probably benign Het
Ephb2 T A 4: 136,659,708 Y736F possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
H2afy T C 13: 56,083,296 probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hpn T C 7: 31,099,898 Y271C possibly damaging Het
Kmt2a A G 9: 44,848,549 S668P probably benign Het
Lgmn T C 12: 102,398,277 D311G probably damaging Het
Mfsd14b T C 13: 65,112,493 probably benign Het
Micu1 C A 10: 59,756,727 probably benign Het
Muc5b A G 7: 141,871,795 I4726V probably benign Het
Nadk2 T A 15: 9,102,992 N310K probably damaging Het
Napg T C 18: 62,983,360 probably benign Het
Nav3 G A 10: 109,716,528 R1818W probably damaging Het
Ntpcr T C 8: 125,737,431 probably benign Het
Olfr1451 A G 19: 12,999,787 D267G probably benign Het
Olfr341 T C 2: 36,479,767 D121G probably damaging Het
Olfr609 T A 7: 103,492,747 I44F probably damaging Het
Olfr807 A G 10: 129,754,997 V151A probably benign Het
Pdia2 A G 17: 26,198,829 F69L probably damaging Het
Pik3r4 A G 9: 105,687,205 T1333A probably damaging Het
Platr26 A T 2: 71,723,287 noncoding transcript Het
Proc T C 18: 32,133,483 D97G probably benign Het
Ptpn23 C T 9: 110,388,777 R700H probably benign Het
Rragc T A 4: 123,924,782 probably null Het
Serac1 A T 17: 6,061,580 F244I probably benign Het
Snrpd3 A G 10: 75,532,205 D52G probably damaging Het
Thrb G T 14: 17,981,837 probably benign Het
Ttc6 T C 12: 57,688,649 probably benign Het
Zfp607b T A 7: 27,702,976 C286S probably benign Het
Other mutations in Krtap4-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01949:Krtap4-9 APN 11 99785565 unclassified probably benign
IGL02697:Krtap4-9 APN 11 99785748 missense unknown
IGL03176:Krtap4-9 APN 11 99785280 unclassified probably benign
R1773:Krtap4-9 UTSW 11 99785570 unclassified probably benign
R1838:Krtap4-9 UTSW 11 99785396 unclassified probably benign
R2566:Krtap4-9 UTSW 11 99785666 unclassified probably benign
R2888:Krtap4-9 UTSW 11 99785419 nonsense probably null
R3757:Krtap4-9 UTSW 11 99785618 unclassified probably benign
R4633:Krtap4-9 UTSW 11 99785554 unclassified probably benign
R5930:Krtap4-9 UTSW 11 99785636 unclassified probably benign
R6092:Krtap4-9 UTSW 11 99785655 unclassified probably benign
R6501:Krtap4-9 UTSW 11 99785429 unclassified probably benign
R6934:Krtap4-9 UTSW 11 99785882 nonsense probably null
R7131:Krtap4-9 UTSW 11 99785457 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCAGACTACCTGCTGTAGGAC -3'
(R):5'- CTAGAGCATGATGGGCGGCAAC -3'

Sequencing Primer
(F):5'- GCTGTAGGACCACCTGCTG -3'
(R):5'- agctggagatgcagcac -3'
Posted On2014-01-05