Incidental Mutation 'R1117:Arpc1b'
ID97408
Institutional Source Beutler Lab
Gene Symbol Arpc1b
Ensembl Gene ENSMUSG00000029622
Gene Nameactin related protein 2/3 complex, subunit 1B
SynonymsSOP2Hs, L72, p41-ARC
MMRRC Submission 039190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1117 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145114215-145130705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145125754 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 226 (V226A)
Ref Sequence ENSEMBL: ENSMUSP00000082822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031627] [ENSMUST00000085679] [ENSMUST00000136074] [ENSMUST00000141602] [ENSMUST00000196111]
Predicted Effect probably benign
Transcript: ENSMUST00000031627
SMART Domains Protein: ENSMUSP00000031627
Gene: ENSMUSG00000029623

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 52 69 N/A INTRINSIC
Pfam:PP28 84 163 3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000085679
AA Change: V226A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082822
Gene: ENSMUSG00000029622
AA Change: V226A

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 233 271 9e-18 BLAST
WD40 317 358 3.55e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129033
Predicted Effect probably benign
Transcript: ENSMUST00000136074
AA Change: V177A

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115022
Gene: ENSMUSG00000029622
AA Change: V177A

DomainStartEndE-ValueType
Pfam:WD40 3 29 2.5e-3 PFAM
WD40 77 121 1.79e-1 SMART
WD40 142 181 7.7e-1 SMART
Blast:WD40 184 222 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138900
Predicted Effect probably benign
Transcript: ENSMUST00000138922
SMART Domains Protein: ENSMUSP00000115515
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
PDB:2P9U|C 2 93 4e-43 PDB
SCOP:d1k8kc_ 35 93 2e-11 SMART
Blast:WD40 50 87 3e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141602
SMART Domains Protein: ENSMUSP00000122340
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Blast:WD40 1 36 2e-15 BLAST
PDB:2P9U|C 1 56 2e-33 PDB
SCOP:d1k8kc_ 9 56 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144375
Predicted Effect possibly damaging
Transcript: ENSMUST00000196111
AA Change: V226A

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143438
Gene: ENSMUSG00000029622
AA Change: V226A

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 237 275 2e-16 BLAST
WD40 321 362 3.55e1 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G A 10: 83,508,623 T353I probably benign Het
Casz1 C A 4: 148,934,595 T451K probably damaging Het
Ccr4 C T 9: 114,492,017 V327M probably benign Het
Cntrl A G 2: 35,127,973 E465G probably damaging Het
Cpa1 A G 6: 30,645,261 D412G probably benign Het
Crispld1 T A 1: 17,749,622 N281K probably benign Het
Cul3 T C 1: 80,280,924 Q465R probably damaging Het
Cyp2c68 G A 19: 39,712,459 T305M probably damaging Het
Elp4 T C 2: 105,842,311 D143G probably benign Het
Etnppl A G 3: 130,634,563 I462M probably benign Het
Fmo4 A G 1: 162,803,663 V245A probably benign Het
Gm4076 A G 13: 85,127,318 noncoding transcript Het
Gm9573 T C 17: 35,620,028 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcnj15 G A 16: 95,295,625 M8I probably benign Het
Klk1b22 A T 7: 44,116,859 M255L probably benign Het
Mmrn1 T A 6: 60,976,325 I530K possibly damaging Het
Nid2 A C 14: 19,763,664 probably null Het
Olfr311 A G 11: 58,841,815 K234E possibly damaging Het
Olfr63 C T 17: 33,268,966 R81* probably null Het
Olfr981 T C 9: 40,022,762 F123S probably damaging Het
Peak1 G A 9: 56,258,418 T742M probably benign Het
Sel1l3 T A 5: 53,172,607 T469S probably benign Het
Sez6 A G 11: 77,974,514 Y659C probably damaging Het
Slc19a2 A T 1: 164,263,456 I278F possibly damaging Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Tcerg1 A G 18: 42,574,652 D1079G probably damaging Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Umod T C 7: 119,477,306 N79S possibly damaging Het
Wdr43 A G 17: 71,616,387 T43A probably benign Het
Other mutations in Arpc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Arpc1b APN 5 145127869 utr 3 prime probably benign
IGL01625:Arpc1b APN 5 145121745 splice site probably null
IGL01859:Arpc1b APN 5 145123730 missense probably damaging 0.98
illusory UTSW 5 145122567 missense probably damaging 1.00
FR4304:Arpc1b UTSW 5 145126791 frame shift probably null
FR4340:Arpc1b UTSW 5 145126792 frame shift probably null
FR4737:Arpc1b UTSW 5 145126787 frame shift probably null
R0110:Arpc1b UTSW 5 145127715 missense probably damaging 1.00
R0245:Arpc1b UTSW 5 145126860 missense probably damaging 1.00
R0469:Arpc1b UTSW 5 145127715 missense probably damaging 1.00
R0652:Arpc1b UTSW 5 145126860 missense probably damaging 1.00
R0827:Arpc1b UTSW 5 145125756 missense probably benign 0.34
R1453:Arpc1b UTSW 5 145125745 missense probably damaging 1.00
R1895:Arpc1b UTSW 5 145122633 missense probably null 0.99
R1946:Arpc1b UTSW 5 145122633 missense probably null 0.99
R2050:Arpc1b UTSW 5 145125919 missense probably damaging 1.00
R2112:Arpc1b UTSW 5 145123769 missense probably damaging 0.99
R4924:Arpc1b UTSW 5 145126815 missense probably benign 0.02
R6534:Arpc1b UTSW 5 145122567 missense probably damaging 1.00
R6883:Arpc1b UTSW 5 145126929 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGCAGAGGCTCAGACTCCATCAAG -3'
(R):5'- AGTGGTAATGTCTCAGAGGCCAGG -3'

Sequencing Primer
(F):5'- TGAATATGCCAGTCCCTCAGG -3'
(R):5'- GGTTGCCACGCTGAAAG -3'
Posted On2014-01-05