Incidental Mutation 'R0989:C4bp'
ID97453
Institutional Source Beutler Lab
Gene Symbol C4bp
Ensembl Gene ENSMUSG00000026405
Gene Namecomplement component 4 binding protein
Synonyms
MMRRC Submission 039109-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.023) question?
Stock #R0989 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location130634773-130661632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130643053 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 262 (T262I)
Ref Sequence ENSEMBL: ENSMUSP00000027657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027657] [ENSMUST00000137276]
Predicted Effect probably benign
Transcript: ENSMUST00000027657
AA Change: T262I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027657
Gene: ENSMUSG00000026405
AA Change: T262I

DomainStartEndE-ValueType
CCP 58 115 3.45e-5 SMART
CCP 120 176 3.17e-13 SMART
CCP 181 240 4.59e-10 SMART
CCP 245 299 3.12e-12 SMART
CCP 303 355 7.28e-13 SMART
CCP 359 413 1.07e-10 SMART
PDB:4B0F|G 416 459 6e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000137276
SMART Domains Protein: ENSMUSP00000121185
Gene: ENSMUSG00000026405

DomainStartEndE-ValueType
CCP 58 115 3.45e-5 SMART
CCP 120 176 3.17e-13 SMART
CCP 181 240 4.59e-10 SMART
Predicted Effect unknown
Transcript: ENSMUST00000171642
AA Change: T96I
SMART Domains Protein: ENSMUSP00000130533
Gene: ENSMUSG00000026405
AA Change: T96I

DomainStartEndE-ValueType
CCP 16 75 4.59e-10 SMART
CCP 80 124 1.38e0 SMART
CCP 125 177 7.28e-13 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,428,544 D140G probably damaging Het
AF529169 T A 9: 89,602,035 K436N probably damaging Het
Atp7b A G 8: 22,028,694 S43P possibly damaging Het
Cdh23 A G 10: 60,534,510 Y169H probably damaging Het
Celsr1 T C 15: 86,031,279 E831G probably benign Het
Celsr2 A C 3: 108,403,272 M1498R probably benign Het
Crim1 T C 17: 78,200,944 V59A probably benign Het
Dnah10 A G 5: 124,797,938 I2560V probably benign Het
Enpp2 A T 15: 54,875,759 M376K possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxw11 T C 11: 32,735,149 V328A probably benign Het
Gm4846 G A 1: 166,487,120 S318L possibly damaging Het
Golm1 A T 13: 59,640,183 Y301N probably benign Het
Ipo8 T C 6: 148,796,682 T614A probably benign Het
Klhl33 T A 14: 50,891,822 Y390F probably damaging Het
Mlh3 A G 12: 85,269,395 S6P probably benign Het
Neurod2 A G 11: 98,327,979 S120P probably damaging Het
Nfkb1 A G 3: 135,589,396 S896P probably benign Het
Nr3c2 T C 8: 77,187,564 Y687H probably damaging Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Olfr552 G A 7: 102,604,483 G43D probably damaging Het
Parp3 C T 9: 106,473,082 probably null Het
Pcolce2 T A 9: 95,638,723 M51K probably benign Het
Pnoc T C 14: 65,404,868 K149E probably damaging Het
Polr1b T G 2: 129,126,077 V1130G probably damaging Het
Prcp A T 7: 92,910,216 I163F probably benign Het
Sez6l2 A G 7: 126,959,844 D361G probably damaging Het
Slc4a9 T A 18: 36,536,867 L785* probably null Het
Ssna1 T C 2: 25,271,563 T91A probably benign Het
St18 A G 1: 6,827,881 T636A probably benign Het
Tln2 C T 9: 67,229,454 A1250T probably damaging Het
Tnk2 A G 16: 32,680,358 M815V probably damaging Het
Tspan31 T A 10: 127,068,327 H167L probably damaging Het
Tspoap1 T A 11: 87,765,823 C287S probably damaging Het
Unc80 T C 1: 66,646,440 F2241S possibly damaging Het
Other mutations in C4bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:C4bp APN 1 130639134 missense probably damaging 1.00
IGL01349:C4bp APN 1 130642928 intron probably benign
IGL01401:C4bp APN 1 130648064 missense possibly damaging 0.95
IGL02252:C4bp APN 1 130636787 missense probably damaging 1.00
IGL02903:C4bp APN 1 130655985 missense probably damaging 1.00
IGL02958:C4bp APN 1 130636795 missense probably damaging 1.00
IGL03061:C4bp APN 1 130636717 missense probably damaging 0.98
R1728:C4bp UTSW 1 130642988 missense probably benign 0.04
R1729:C4bp UTSW 1 130642988 missense probably benign 0.04
R1730:C4bp UTSW 1 130642988 missense probably benign 0.04
R1739:C4bp UTSW 1 130642988 missense probably benign 0.04
R1762:C4bp UTSW 1 130642988 missense probably benign 0.04
R1783:C4bp UTSW 1 130642988 missense probably benign 0.04
R1784:C4bp UTSW 1 130642988 missense probably benign 0.04
R1785:C4bp UTSW 1 130642988 missense probably benign 0.04
R1942:C4bp UTSW 1 130656067 splice site probably benign
R2006:C4bp UTSW 1 130648032 nonsense probably null
R3877:C4bp UTSW 1 130648027 critical splice donor site probably null
R4446:C4bp UTSW 1 130642955 missense probably benign 0.06
R4551:C4bp UTSW 1 130636727 missense possibly damaging 0.46
R4552:C4bp UTSW 1 130636727 missense possibly damaging 0.46
R4727:C4bp UTSW 1 130639185 missense probably benign 0.19
R4761:C4bp UTSW 1 130653421 missense possibly damaging 0.83
R5620:C4bp UTSW 1 130653353 missense probably damaging 1.00
R6110:C4bp UTSW 1 130639072 nonsense probably null
R6189:C4bp UTSW 1 130636819 missense probably damaging 1.00
R6344:C4bp UTSW 1 130656015 missense probably benign 0.12
R6418:C4bp UTSW 1 130656013 missense probably damaging 1.00
R6895:C4bp UTSW 1 130636206 makesense probably null
R6964:C4bp UTSW 1 130657272 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCGACATCAACAGTACCAGTGCC -3'
(R):5'- TTCTAGCTTCAGGGGAGTCTCTTAGC -3'

Sequencing Primer
(F):5'- CTATGTATGACAGATGACCTGGC -3'
(R):5'- cacaagtgaatgataccatgcc -3'
Posted On2014-01-05