Mutagenetix > Incidental Mutation

Incidental Mutation 'R1118:Cubn'

97501

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin

Synonyms

D2Wsu88e, intrinsic factor-cobalamin receptor

MMRRC Submission

039191-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1118 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13281149-13496624 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13341053 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 2223 (I2223V)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091436
AA Change: I2223V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: I2223V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Meta Mutation Damage Score

0.1768

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 94.3%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apcdd1	A	G	18: 63,085,095 (GRCm39)	T431A	probably benign	Het
Bcan	T	A	3: 87,896,534 (GRCm39)	I721F	probably damaging	Het
Card10	T	C	15: 78,686,643 (GRCm39)	D58G	possibly damaging	Het
Cd200r2	A	G	16: 44,729,969 (GRCm39)	N171S	probably damaging	Het
Celsr1	T	C	15: 85,916,248 (GRCm39)	D575G	probably damaging	Het
Ces1f	A	G	8: 93,993,870 (GRCm39)		probably benign	Het
Cped1	A	T	6: 22,237,698 (GRCm39)	H938L	probably benign	Het
Creld1	A	G	6: 113,468,656 (GRCm39)	D259G	probably benign	Het
Dop1a	A	G	9: 86,397,459 (GRCm39)	D921G	probably damaging	Het
Dusp7	T	C	9: 106,250,849 (GRCm39)	S325P	possibly damaging	Het
Fat4	A	T	3: 39,037,091 (GRCm39)	D3581V	possibly damaging	Het
Fhl3	T	C	4: 124,599,584 (GRCm39)		probably null	Het
Gap43	T	C	16: 42,112,167 (GRCm39)	E198G	probably benign	Het
Garin4	G	A	1: 190,896,682 (GRCm39)		probably benign	Het
Grina	T	C	15: 76,132,779 (GRCm39)	F182S	probably damaging	Het
Gsk3b	T	C	16: 38,028,346 (GRCm39)		probably benign	Het
Gtf3c3	C	T	1: 54,456,937 (GRCm39)	A488T	probably damaging	Het
Haus6	A	G	4: 86,503,563 (GRCm39)		probably null	Het
Hmcn1	C	T	1: 150,494,679 (GRCm39)	A4137T	possibly damaging	Het
Itih4	C	A	14: 30,618,124 (GRCm39)		probably benign	Het
Itprid1	T	C	6: 55,866,155 (GRCm39)	F183L	probably damaging	Het
Kif22	A	G	7: 126,631,916 (GRCm39)	S384P	probably benign	Het
Lbr	A	C	1: 181,648,233 (GRCm39)		probably benign	Het
Mei1	G	A	15: 82,000,068 (GRCm39)		probably benign	Het
Misp	T	C	10: 79,662,969 (GRCm39)	V462A	probably benign	Het
Mrgpra3	A	C	7: 47,239,039 (GRCm39)	L296V	possibly damaging	Het
Ndufa9	A	T	6: 126,799,031 (GRCm39)	L362Q	probably damaging	Het
Nlrp9c	A	T	7: 26,083,862 (GRCm39)	D572E	probably benign	Het
Or4f14	T	A	2: 111,743,222 (GRCm39)	T18S	probably benign	Het
Otud4	C	T	8: 80,379,980 (GRCm39)		probably benign	Het
P4ha3	T	C	7: 99,962,535 (GRCm39)	I431T	probably damaging	Het
Pcdhb15	T	A	18: 37,606,815 (GRCm39)	F16I	probably benign	Het
Pcnp	A	G	16: 55,844,754 (GRCm39)	S49P	probably damaging	Het
Pdxdc1	T	A	16: 13,697,278 (GRCm39)		probably benign	Het
Pgc	T	A	17: 48,039,828 (GRCm39)		probably null	Het
Phf11a	T	C	14: 59,521,778 (GRCm39)	D131G	probably benign	Het
Prdm2	G	A	4: 142,858,953 (GRCm39)	H1446Y	possibly damaging	Het
Rad54b	T	C	4: 11,563,352 (GRCm39)	S4P	probably damaging	Het
Slc52a2	T	C	15: 76,423,808 (GRCm39)		probably benign	Het
Slc9a4	G	A	1: 40,623,490 (GRCm39)		probably benign	Het
Smad4	T	C	18: 73,773,333 (GRCm39)	D551G	probably benign	Het
Smg7	A	T	1: 152,742,326 (GRCm39)		probably benign	Het
Sned1	G	A	1: 93,209,376 (GRCm39)	V830M	possibly damaging	Het
Sspo	A	G	6: 48,436,352 (GRCm39)	Y1234C	probably damaging	Het
Stab2	A	T	10: 86,721,582 (GRCm39)		probably null	Het
Stk36	A	G	1: 74,671,925 (GRCm39)	E875G	probably benign	Het
Stmn4	T	G	14: 66,591,844 (GRCm39)		probably benign	Het
Tagln3	C	A	16: 45,544,635 (GRCm39)	R12L	probably damaging	Het
Tex14	A	T	11: 87,413,343 (GRCm39)	R1031S	probably benign	Het
Tia1	G	A	6: 86,396,091 (GRCm39)	V96I	probably benign	Het
Ticrr	C	T	7: 79,343,701 (GRCm39)	P1189S	probably benign	Het
Tnxb	G	A	17: 34,904,017 (GRCm39)	V1053M	probably damaging	Het
Tpp2	T	C	1: 44,031,556 (GRCm39)		probably null	Het
Trpm7	A	G	2: 126,664,406 (GRCm39)	M991T	possibly damaging	Het
Ttc3	T	A	16: 94,217,127 (GRCm39)		probably benign	Het
Vcan	G	A	13: 89,853,782 (GRCm39)	P393S	probably damaging	Het
Vmn2r107	G	A	17: 20,576,860 (GRCm39)	R286Q	probably benign	Het
Wdr87-ps	G	A	7: 29,233,669 (GRCm39)		noncoding transcript	Het
Wrap73	A	T	4: 154,236,884 (GRCm39)		probably null	Het
Zfp958	A	T	8: 4,676,169 (GRCm39)	N46Y	possibly damaging	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13,496,631 (GRCm39)	unclassified	probably benign
IGL00228:Cubn	APN	2	13,461,508 (GRCm39)	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13,386,660 (GRCm39)	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13,431,867 (GRCm39)	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13,283,229 (GRCm39)	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13,287,730 (GRCm39)	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13,299,041 (GRCm39)	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13,472,521 (GRCm39)	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13,386,738 (GRCm39)	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13,461,434 (GRCm39)	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13,283,219 (GRCm39)	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13,482,904 (GRCm39)	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13,315,377 (GRCm39)	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13,470,719 (GRCm39)	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13,288,852 (GRCm39)	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13,355,673 (GRCm39)	splice site	probably benign
IGL01534:Cubn	APN	2	13,470,744 (GRCm39)	nonsense	probably null
IGL01584:Cubn	APN	2	13,313,472 (GRCm39)	splice site	probably benign
IGL01595:Cubn	APN	2	13,330,027 (GRCm39)	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13,311,085 (GRCm39)	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13,494,747 (GRCm39)	nonsense	probably null
IGL01972:Cubn	APN	2	13,450,883 (GRCm39)	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13,292,405 (GRCm39)	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13,344,657 (GRCm39)	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13,386,648 (GRCm39)	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13,432,645 (GRCm39)	splice site	probably null
IGL02491:Cubn	APN	2	13,326,039 (GRCm39)	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13,330,037 (GRCm39)	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13,450,843 (GRCm39)	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13,449,851 (GRCm39)	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13,299,181 (GRCm39)	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13,323,123 (GRCm39)	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13,291,905 (GRCm39)	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13,360,500 (GRCm39)	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13,431,778 (GRCm39)	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13,365,140 (GRCm39)	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13,482,868 (GRCm39)	splice site	probably null
mellow	UTSW	2	13,482,889 (GRCm39)	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13,473,663 (GRCm39)	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13,496,561 (GRCm39)	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13,311,243 (GRCm39)	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13,361,520 (GRCm39)	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13,480,846 (GRCm39)	critical splice donor site	probably null
R0254:Cubn	UTSW	2	13,445,325 (GRCm39)	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13,429,505 (GRCm39)	missense	probably benign	0.01
R0360:Cubn	UTSW	2	13,315,318 (GRCm39)	splice site	probably benign
R0364:Cubn	UTSW	2	13,315,318 (GRCm39)	splice site	probably benign
R0383:Cubn	UTSW	2	13,435,770 (GRCm39)	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13,474,575 (GRCm39)	missense	possibly damaging	0.87
R0419:Cubn	UTSW	2	13,474,574 (GRCm39)	missense	possibly damaging	0.77
R0498:Cubn	UTSW	2	13,449,078 (GRCm39)	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13,433,491 (GRCm39)	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13,365,063 (GRCm39)	splice site	probably null
R0735:Cubn	UTSW	2	13,496,500 (GRCm39)	splice site	probably benign
R0780:Cubn	UTSW	2	13,461,424 (GRCm39)	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13,367,139 (GRCm39)	missense	possibly damaging	0.54
R1182:Cubn	UTSW	2	13,449,811 (GRCm39)	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13,292,379 (GRCm39)	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13,365,130 (GRCm39)	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13,330,099 (GRCm39)	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13,330,099 (GRCm39)	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13,480,931 (GRCm39)	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13,431,916 (GRCm39)	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13,292,472 (GRCm39)	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13,432,778 (GRCm39)	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13,474,600 (GRCm39)	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13,494,128 (GRCm39)	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13,313,372 (GRCm39)	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13,327,813 (GRCm39)	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13,315,337 (GRCm39)	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13,283,349 (GRCm39)	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13,344,828 (GRCm39)	splice site	probably null
R2021:Cubn	UTSW	2	13,313,360 (GRCm39)	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13,340,978 (GRCm39)	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13,449,189 (GRCm39)	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13,340,978 (GRCm39)	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13,323,053 (GRCm39)	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13,408,891 (GRCm39)	nonsense	probably null
R2369:Cubn	UTSW	2	13,496,028 (GRCm39)	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13,480,961 (GRCm39)	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13,323,083 (GRCm39)	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13,283,167 (GRCm39)	splice site	probably null
R2850:Cubn	UTSW	2	13,327,764 (GRCm39)	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13,435,645 (GRCm39)	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13,362,950 (GRCm39)	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13,367,158 (GRCm39)	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13,367,158 (GRCm39)	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13,362,973 (GRCm39)	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13,338,319 (GRCm39)	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13,336,396 (GRCm39)	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13,432,725 (GRCm39)	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13,365,164 (GRCm39)	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13,299,136 (GRCm39)	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13,287,819 (GRCm39)	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13,287,819 (GRCm39)	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13,291,791 (GRCm39)	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13,331,488 (GRCm39)	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13,318,810 (GRCm39)	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13,433,374 (GRCm39)	intron	probably benign
R4405:Cubn	UTSW	2	13,470,841 (GRCm39)	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13,433,560 (GRCm39)	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13,318,790 (GRCm39)	splice site	probably null
R4770:Cubn	UTSW	2	13,319,578 (GRCm39)	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13,291,835 (GRCm39)	missense	possibly damaging	0.94
R4799:Cubn	UTSW	2	13,355,869 (GRCm39)	missense	probably damaging	1.00
R4812:Cubn	UTSW	2	13,463,887 (GRCm39)	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13,330,036 (GRCm39)	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13,494,721 (GRCm39)	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13,352,856 (GRCm39)	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13,292,379 (GRCm39)	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13,483,013 (GRCm39)	nonsense	probably null
R5305:Cubn	UTSW	2	13,393,750 (GRCm39)	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13,496,506 (GRCm39)	splice site	probably null
R5530:Cubn	UTSW	2	13,313,334 (GRCm39)	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13,355,743 (GRCm39)	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13,393,702 (GRCm39)	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13,324,834 (GRCm39)	splice site	probably benign
R5923:Cubn	UTSW	2	13,490,889 (GRCm39)	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13,329,995 (GRCm39)	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13,329,995 (GRCm39)	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13,435,708 (GRCm39)	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13,432,658 (GRCm39)	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13,313,429 (GRCm39)	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13,354,687 (GRCm39)	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13,482,889 (GRCm39)	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13,285,006 (GRCm39)	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13,480,934 (GRCm39)	missense	probably damaging	0.98
R6368:Cubn	UTSW	2	13,435,806 (GRCm39)	missense	probably damaging	0.96
R6383:Cubn	UTSW	2	13,432,646 (GRCm39)	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13,360,491 (GRCm39)	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13,299,014 (GRCm39)	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13,463,813 (GRCm39)	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13,315,484 (GRCm39)	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13,435,683 (GRCm39)	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13,480,875 (GRCm39)	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13,326,066 (GRCm39)	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13,449,840 (GRCm39)	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13,449,064 (GRCm39)	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13,323,089 (GRCm39)	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13,352,840 (GRCm39)	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13,386,648 (GRCm39)	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13,491,600 (GRCm39)	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13,311,092 (GRCm39)	missense	probably benign	0.10
R7076:Cubn	UTSW	2	13,311,091 (GRCm39)	missense	probably benign	0.00
R7086:Cubn	UTSW	2	13,324,669 (GRCm39)	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13,347,309 (GRCm39)	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13,355,814 (GRCm39)	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13,429,550 (GRCm39)	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13,345,143 (GRCm39)	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13,473,582 (GRCm39)	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13,291,875 (GRCm39)	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13,431,778 (GRCm39)	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13,460,320 (GRCm39)	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13,494,728 (GRCm39)	missense	possibly damaging	0.74
R7699:Cubn	UTSW	2	13,352,989 (GRCm39)	missense	probably benign
R7700:Cubn	UTSW	2	13,494,728 (GRCm39)	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13,352,989 (GRCm39)	missense	probably benign
R7751:Cubn	UTSW	2	13,365,176 (GRCm39)	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13,284,889 (GRCm39)	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13,352,961 (GRCm39)	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13,473,680 (GRCm39)	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13,429,538 (GRCm39)	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13,337,166 (GRCm39)	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13,340,897 (GRCm39)	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13,483,989 (GRCm39)	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13,336,471 (GRCm39)	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13,393,659 (GRCm39)	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13,299,129 (GRCm39)	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13,354,688 (GRCm39)	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13,491,613 (GRCm39)	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13,311,274 (GRCm39)	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13,345,053 (GRCm39)	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13,435,658 (GRCm39)	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13,433,535 (GRCm39)	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13,329,971 (GRCm39)	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13,433,567 (GRCm39)	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13,386,610 (GRCm39)	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13,432,658 (GRCm39)	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13,318,855 (GRCm39)	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13,313,331 (GRCm39)	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13,388,770 (GRCm39)	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13,313,377 (GRCm39)	nonsense	probably null
R8874:Cubn	UTSW	2	13,365,157 (GRCm39)	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13,461,466 (GRCm39)	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13,291,914 (GRCm39)	missense	probably benign	0.02
R9143:Cubn	UTSW	2	13,337,276 (GRCm39)	splice site	probably benign
R9261:Cubn	UTSW	2	13,283,262 (GRCm39)	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13,386,703 (GRCm39)	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13,463,767 (GRCm39)	missense	probably damaging	0.99
R9603:Cubn	UTSW	2	13,292,510 (GRCm39)	missense	probably damaging	1.00
R9614:Cubn	UTSW	2	13,482,945 (GRCm39)	missense	probably benign	0.00
R9615:Cubn	UTSW	2	13,325,991 (GRCm39)	missense	possibly damaging	0.88
R9616:Cubn	UTSW	2	13,319,529 (GRCm39)	missense	probably benign	0.04
R9774:Cubn	UTSW	2	13,433,530 (GRCm39)	missense	probably benign
X0018:Cubn	UTSW	2	13,463,797 (GRCm39)	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13,480,887 (GRCm39)	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13,347,392 (GRCm39)	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13,327,773 (GRCm39)	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13,388,803 (GRCm39)	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13,299,040 (GRCm39)	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13,386,636 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACACGGAATATGCAGCTAGACCGAA -3'
(R):5'- ACATTTTAAAGCGAAGCACCTGACCT -3'

Sequencing Primer
(F):5'- AGGCTTCAGGCATTAACTCATC -3'
(R):5'- AGGACATACATGGTAGCTCCTTTTC -3'

Posted On

2014-01-05