Incidental Mutation 'R0990:Cog8'
ID97627
Institutional Source Beutler Lab
Gene Symbol Cog8
Ensembl Gene ENSMUSG00000031916
Gene Namecomponent of oligomeric golgi complex 8
SynonymsC87832
MMRRC Submission 039110-MU
Accession Numbers

Genbank: NM_139229; MGI: 2142885

Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R0990 (G1)
Quality Score191
Status Not validated
Chromosome8
Chromosomal Location107046289-107056689 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 107052487 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034391] [ENSMUST00000034392] [ENSMUST00000055316] [ENSMUST00000095517] [ENSMUST00000170962]
Predicted Effect probably benign
Transcript: ENSMUST00000034391
AA Change: Q386L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034391
Gene: ENSMUSG00000031916
AA Change: Q386L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034392
SMART Domains Protein: ENSMUSP00000034392
Gene: ENSMUSG00000031917

DomainStartEndE-ValueType
PUA 95 170 4.36e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055316
SMART Domains Protein: ENSMUSP00000138676
Gene: ENSMUSG00000078931

DomainStartEndE-ValueType
Pfam:Pep_deformylase 52 222 2.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095517
AA Change: Q386L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093173
Gene: ENSMUSG00000031916
AA Change: Q386L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122903
Predicted Effect probably benign
Transcript: ENSMUST00000134772
Predicted Effect probably null
Transcript: ENSMUST00000170962
SMART Domains Protein: ENSMUSP00000126153
Gene: ENSMUSG00000031917

DomainStartEndE-ValueType
PDB:1T5Y|A 1 133 7e-87 PDB
Blast:PUA 95 123 5e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212281
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the conserved oligomeric Golgi (COG) complex, a multiprotein complex that plays a structural role in the Golgi apparatus, and is involved in intracellular membrane trafficking and glycoprotein modification. Mutations in this gene cause congenital disorder of glycosylation, type IIh, a disease that is characterized by under-glycosylated serum proteins, and whose symptoms include severe psychomotor retardation, failure to thrive, seizures, and dairy and wheat product intolerance. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Targeted, other(2) Gene trapped(20)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 T C 8: 88,325,452 V916A possibly damaging Het
Ank2 T C 3: 126,934,666 I759M possibly damaging Het
Arhgap32 A G 9: 32,255,381 D438G probably damaging Het
Arhgef12 T C 9: 42,972,381 Y1285C probably benign Het
Cfap65 A G 1: 74,921,519 V764A possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo24 T C 5: 137,618,439 N394S probably damaging Het
Gm9938 A G 19: 23,724,592 probably benign Het
Iars2 A G 1: 185,318,627 F422L probably damaging Het
March3 A T 18: 56,807,798 C87S probably damaging Het
Mettl2 T A 11: 105,137,744 Y307* probably null Het
Mlh3 T C 12: 85,267,765 D549G probably benign Het
Muc4 A G 16: 32,752,722 T867A probably benign Het
Nup210l A T 3: 90,211,925 T1852S probably benign Het
Olfr1110 T A 2: 87,135,742 H193L possibly damaging Het
Pdk4 A T 6: 5,485,577 S371T probably benign Het
Pkm A G 9: 59,678,096 T454A probably damaging Het
Satb2 G A 1: 56,850,184 S340F probably damaging Het
Scel G A 14: 103,581,832 V354I possibly damaging Het
Setdb1 T C 3: 95,340,265 T440A probably benign Het
Sgk1 T C 10: 21,997,086 F230S probably damaging Het
Slc22a23 A T 13: 34,195,467 I439N probably damaging Het
Slc9a5 G A 8: 105,359,446 R615Q probably damaging Het
Smad1 T A 8: 79,343,788 I374F probably damaging Het
Tgm4 A G 9: 123,046,511 E143G probably benign Het
Vmn2r53 A G 7: 12,581,502 S797P probably benign Het
Other mutations in Cog8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Cog8 APN 8 107054065 missense probably benign 0.23
IGL01959:Cog8 APN 8 107056378 missense probably damaging 1.00
IGL02563:Cog8 APN 8 107056423 missense possibly damaging 0.70
IGL02961:Cog8 APN 8 107056253 unclassified probably benign
R0076:Cog8 UTSW 8 107054133 missense possibly damaging 0.96
R0255:Cog8 UTSW 8 107049145 unclassified probably benign
R0433:Cog8 UTSW 8 107056478 missense possibly damaging 0.52
R1457:Cog8 UTSW 8 107052896 missense probably damaging 1.00
R1567:Cog8 UTSW 8 107054108 nonsense probably null
R2239:Cog8 UTSW 8 107056361 missense probably damaging 1.00
R2380:Cog8 UTSW 8 107056361 missense probably damaging 1.00
R2910:Cog8 UTSW 8 107054221 missense probably benign 0.25
R3978:Cog8 UTSW 8 107053037 missense probably damaging 1.00
R4560:Cog8 UTSW 8 107052211 critical splice donor site probably null
R4863:Cog8 UTSW 8 107050174 missense probably damaging 1.00
R4879:Cog8 UTSW 8 107056352 missense probably damaging 0.99
R5026:Cog8 UTSW 8 107049125 missense probably benign
R5721:Cog8 UTSW 8 107050148 missense probably benign 0.00
R6489:Cog8 UTSW 8 107050301 missense probably benign 0.00
T0722:Cog8 UTSW 8 107048993 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCAGTCACATCCTGTGCTAGAG -3'
(R):5'- CATGGGCGAGTACACTGTGAATGAG -3'

Sequencing Primer
(F):5'- TGTGCTAGAGCCACAGGG -3'
(R):5'- TACACTGTGAATGAGGGTGC -3'
Posted On2014-01-05