Mutagenetix > Incidental Mutation

Incidental Mutation 'R0993:Lmbr1'

97840

Institutional Source

Beutler Lab

Gene Symbol

Lmbr1

Ensembl Gene

ENSMUSG00000010721

Gene Name

limb region 1

Synonyms

1110048D14Rik, C79130

MMRRC Submission

039113-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0993 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29434800-29583414 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 29492391 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 66 (H66L)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055195] [ENSMUST00000179191] [ENSMUST00000196321] [ENSMUST00000198105] [ENSMUST00000200564]

AlphaFold

Q9JIT0

Predicted Effect

probably benign
Transcript: ENSMUST00000055195
AA Change: H252L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000058405
Gene: ENSMUSG00000010721
AA Change: H252L

Domain	Start	End	E-Value	Type
Pfam:LMBR1	26	281	3.5e-46	PFAM
Pfam:LMBR1	239	445	1.7e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179191
AA Change: H224L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136160
Gene: ENSMUSG00000010721
AA Change: H224L

Domain	Start	End	E-Value	Type
Pfam:LMBR1	23	108	6e-31	PFAM
Pfam:LMBR1	106	418	5.3e-99	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196321
AA Change: H129L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000143348
Gene: ENSMUSG00000010721
AA Change: H129L

Domain	Start	End	E-Value	Type
Pfam:LMBR1	1	323	4e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198105
AA Change: H225L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142755
Gene: ENSMUSG00000010721
AA Change: H225L

Domain	Start	End	E-Value	Type
Pfam:LMBR1	23	107	5.4e-30	PFAM
Pfam:LMBR1	106	419	3.4e-101	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198367

Predicted Effect

probably damaging
Transcript: ENSMUST00000200149
AA Change: H66L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000200564
AA Change: H129L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000143316
Gene: ENSMUSG00000010721
AA Change: H129L

Domain	Start	End	E-Value	Type
Pfam:LMBR1	1	310	8.6e-92	PFAM

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.2%
20x: 89.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the LMBR1-like membrane protein family. Another member of this protein family has been shown to be a lipocalin transmembrane receptor. A highly conserved, cis-acting regulatory module for the sonic hedgehog gene is located within an intron of this gene. Consequently, disruption of this genic region can alter sonic hedgehog expression and affect limb patterning, but it is not known if this gene functions directly in limb development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show minor coalitions of distal wrist bones and a low incidence of limb defects, including oligodactyly, brachyphalangia, and soft tissue or bony syndactyly. Homozygotes for another null allele exhibit normal morphology,clinical chemistry, hematology and behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
D6Ertd527e	C	G	6: 87,088,506 (GRCm39)	T223S	unknown	Het
Eml5	T	C	12: 98,827,442 (GRCm39)	E596G	probably benign	Het
Eri3	C	A	4: 117,421,860 (GRCm39)	T46K	possibly damaging	Het
Etv1	C	T	12: 38,877,863 (GRCm39)	P68S	probably damaging	Het
Fbxl8	C	A	8: 105,993,717 (GRCm39)	D24E	probably damaging	Het
Gm19965	A	T	1: 116,749,555 (GRCm39)	N412I	probably benign	Het
Nrbp1	T	A	5: 31,403,157 (GRCm39)	I210N	probably damaging	Het
Or8j3b	T	G	2: 86,205,222 (GRCm39)	Y178S	probably damaging	Het
Polr1has	TCACCACCACCACCACCACCACCAC	TCACCACCACCACCACCACCAC	17: 37,275,939 (GRCm39)		probably benign	Het
Prl2c2	G	C	13: 13,176,786 (GRCm39)	T47R	probably damaging	Het
Samd8	T	A	14: 21,825,563 (GRCm39)	V173D	probably damaging	Het
Shf	G	A	2: 122,199,163 (GRCm39)	P51S	probably damaging	Het
Slc2a9	T	A	5: 38,539,406 (GRCm39)	T365S	probably damaging	Het
Slc32a1	T	C	2: 158,453,340 (GRCm39)	M60T	possibly damaging	Het
Slx4	T	C	16: 3,803,689 (GRCm39)	S1042G	probably benign	Het
Stard9	T	C	2: 120,535,650 (GRCm39)	L193P	probably damaging	Het
Tln1	T	C	4: 43,549,825 (GRCm39)	K529E	probably benign	Het
Vps13d	G	A	4: 144,844,262 (GRCm39)	R1342*	probably null	Het

Other mutations in Lmbr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01645:Lmbr1	APN	5	29,440,053 (GRCm39)	missense	probably damaging	1.00
IGL02285:Lmbr1	APN	5	29,459,233 (GRCm39)	splice site	probably benign
IGL02793:Lmbr1	APN	5	29,497,186 (GRCm39)	missense	probably damaging	1.00
IGL02875:Lmbr1	APN	5	29,497,186 (GRCm39)	missense	probably damaging	1.00
IGL03103:Lmbr1	APN	5	29,440,014 (GRCm39)	missense	probably damaging	0.99
IGL02988:Lmbr1	UTSW	5	29,497,221 (GRCm39)	splice site	probably null
R0255:Lmbr1	UTSW	5	29,457,753 (GRCm39)	missense	probably damaging	1.00
R0594:Lmbr1	UTSW	5	29,497,207 (GRCm39)	missense	possibly damaging	0.87
R1036:Lmbr1	UTSW	5	29,463,745 (GRCm39)	missense	probably damaging	1.00
R1570:Lmbr1	UTSW	5	29,459,556 (GRCm39)	missense	probably damaging	1.00
R1724:Lmbr1	UTSW	5	29,566,081 (GRCm39)	missense	probably benign	0.03
R2056:Lmbr1	UTSW	5	29,438,092 (GRCm39)	missense	probably benign	0.07
R2996:Lmbr1	UTSW	5	29,568,931 (GRCm39)	missense	probably benign	0.29
R4082:Lmbr1	UTSW	5	29,463,753 (GRCm39)	missense	probably damaging	1.00
R4618:Lmbr1	UTSW	5	29,551,863 (GRCm39)	missense	probably damaging	1.00
R4842:Lmbr1	UTSW	5	29,492,424 (GRCm39)	missense	probably damaging	0.97
R4857:Lmbr1	UTSW	5	29,528,807 (GRCm39)	missense	probably damaging	0.98
R5495:Lmbr1	UTSW	5	29,551,851 (GRCm39)	nonsense	probably null
R5647:Lmbr1	UTSW	5	29,468,391 (GRCm39)	critical splice donor site	probably null
R6393:Lmbr1	UTSW	5	29,459,292 (GRCm39)	missense	probably damaging	1.00
R6466:Lmbr1	UTSW	5	29,583,166 (GRCm39)	missense	probably benign	0.05
R6486:Lmbr1	UTSW	5	29,528,859 (GRCm39)	missense	probably damaging	0.99
R6576:Lmbr1	UTSW	5	29,496,308 (GRCm39)	missense	probably damaging	1.00
R6874:Lmbr1	UTSW	5	29,497,904 (GRCm39)	missense	probably damaging	1.00
R7085:Lmbr1	UTSW	5	29,566,090 (GRCm39)	splice site	probably null
R7484:Lmbr1	UTSW	5	29,551,850 (GRCm39)	start gained	probably benign
R7487:Lmbr1	UTSW	5	29,459,262 (GRCm39)	missense	probably benign	0.38
R8390:Lmbr1	UTSW	5	29,440,040 (GRCm39)	missense	probably benign	0.00
R9006:Lmbr1	UTSW	5	29,551,900 (GRCm39)	missense	probably benign	0.03
R9596:Lmbr1	UTSW	5	29,440,105 (GRCm39)	nonsense	probably null
Z1088:Lmbr1	UTSW	5	29,528,814 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGTAAGTGTGCAGCCCTTTTAAC -3'
(R):5'- TGCTTCCGTAGTCCCTGAGAATGC -3'

Sequencing Primer
(F):5'- TGTCCAAGGAGCACTGTG -3'
(R):5'- TCCCTGAGAATGCTACAAAGTG -3'

Posted On

2014-01-05