Incidental Mutation 'R0993:D6Ertd527e'
ID97848
Institutional Source Beutler Lab
Gene Symbol D6Ertd527e
Ensembl Gene ENSMUSG00000090891
Gene NameDNA segment, Chr 6, ERATO Doi 527, expressed
Synonyms
MMRRC Submission 039113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R0993 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location87104746-87112997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 87111524 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 223 (T223S)
Ref Sequence ENSEMBL: ENSMUSP00000145529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170124] [ENSMUST00000203747] [ENSMUST00000204927]
Predicted Effect unknown
Transcript: ENSMUST00000170124
AA Change: T222S
SMART Domains Protein: ENSMUSP00000130803
Gene: ENSMUSG00000090891
AA Change: T222S

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203725
Predicted Effect unknown
Transcript: ENSMUST00000203747
AA Change: T222S
SMART Domains Protein: ENSMUSP00000144761
Gene: ENSMUSG00000090891
AA Change: T222S

DomainStartEndE-ValueType
low complexity region 5 182 N/A INTRINSIC
internal_repeat_1 185 206 1.04e-33 PROSPERO
low complexity region 211 242 N/A INTRINSIC
internal_repeat_2 243 253 2.12e-11 PROSPERO
internal_repeat_2 259 269 2.12e-11 PROSPERO
low complexity region 271 293 N/A INTRINSIC
internal_repeat_1 296 317 1.04e-33 PROSPERO
low complexity region 322 458 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204927
AA Change: T223S
SMART Domains Protein: ENSMUSP00000145529
Gene: ENSMUSG00000090891
AA Change: T223S

DomainStartEndE-ValueType
low complexity region 7 183 N/A INTRINSIC
internal_repeat_1 186 207 1.15e-33 PROSPERO
low complexity region 212 243 N/A INTRINSIC
internal_repeat_2 244 254 2.22e-11 PROSPERO
internal_repeat_2 260 270 2.22e-11 PROSPERO
low complexity region 272 294 N/A INTRINSIC
internal_repeat_1 297 318 1.15e-33 PROSPERO
low complexity region 323 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205257
Meta Mutation Damage Score 0.0492 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Eml5 T C 12: 98,861,183 E596G probably benign Het
Eri3 C A 4: 117,564,663 T46K possibly damaging Het
Etv1 C T 12: 38,827,864 P68S probably damaging Het
Fbxl8 C A 8: 105,267,085 D24E probably damaging Het
Gm19965 A T 1: 116,821,825 N412I probably benign Het
Lmbr1 T A 5: 29,287,393 H66L probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr1057 T G 2: 86,374,878 Y178S probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Samd8 T A 14: 21,775,495 V173D probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc2a9 T A 5: 38,382,063 T365S probably damaging Het
Slc32a1 T C 2: 158,611,420 M60T possibly damaging Het
Slx4 T C 16: 3,985,825 S1042G probably benign Het
Stard9 T C 2: 120,705,169 L193P probably damaging Het
Tln1 T C 4: 43,549,825 K529E probably benign Het
Vps13d G A 4: 145,117,692 R1342* probably null Het
Znrd1as TCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCAC 17: 36,965,047 probably benign Het
Other mutations in D6Ertd527e
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0325:D6Ertd527e UTSW 6 87111295 missense unknown
R0415:D6Ertd527e UTSW 6 87111524 missense unknown
R0607:D6Ertd527e UTSW 6 87111905 missense unknown
R0739:D6Ertd527e UTSW 6 87111668 missense unknown
R0992:D6Ertd527e UTSW 6 87111524 missense unknown
R1193:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1195:D6Ertd527e UTSW 6 87111524 missense unknown
R1196:D6Ertd527e UTSW 6 87111524 missense unknown
R1386:D6Ertd527e UTSW 6 87111524 missense unknown
R1413:D6Ertd527e UTSW 6 87111353 missense unknown
R1485:D6Ertd527e UTSW 6 87111085 missense unknown
R1560:D6Ertd527e UTSW 6 87111524 missense unknown
R1561:D6Ertd527e UTSW 6 87111524 missense unknown
R1568:D6Ertd527e UTSW 6 87111524 missense unknown
R2290:D6Ertd527e UTSW 6 87111545 missense unknown
R4155:D6Ertd527e UTSW 6 87111524 missense unknown
R4461:D6Ertd527e UTSW 6 87111317 missense unknown
R4836:D6Ertd527e UTSW 6 87111424 small insertion probably benign
R5102:D6Ertd527e UTSW 6 87111811 missense unknown
R5149:D6Ertd527e UTSW 6 87111524 missense unknown
R5150:D6Ertd527e UTSW 6 87111524 missense unknown
R5681:D6Ertd527e UTSW 6 87111206 missense unknown
R6250:D6Ertd527e UTSW 6 87111212 missense unknown
R6398:D6Ertd527e UTSW 6 87111524 missense unknown
R6441:D6Ertd527e UTSW 6 87111524 missense unknown
R7001:D6Ertd527e UTSW 6 87111212 missense unknown
R7142:D6Ertd527e UTSW 6 87111524 missense unknown
R7297:D6Ertd527e UTSW 6 87111524 missense unknown
S24628:D6Ertd527e UTSW 6 87111524 missense unknown
V1662:D6Ertd527e UTSW 6 87111892 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCATCAGACCTAGTAACAGGGGC -3'
(R):5'- GCTGCTGCTACTGCTGCTGC -3'

Sequencing Primer
(F):5'- gcagcatcagcaactatgac -3'
(R):5'- tactgctgctgctgctg -3'
Posted On2014-01-05