Incidental Mutation 'R1101:Pcdh18'
ID98068
Institutional Source Beutler Lab
Gene Symbol Pcdh18
Ensembl Gene ENSMUSG00000037892
Gene Nameprotocadherin 18
SynonymsPCDH68L
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location49743296-49757325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49753379 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 882 (D882V)
Ref Sequence ENSEMBL: ENSMUSP00000141995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035931] [ENSMUST00000191794]
Predicted Effect probably damaging
Transcript: ENSMUST00000035931
AA Change: D881V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039245
Gene: ENSMUSG00000037892
AA Change: D881V

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
CA 51 135 1.36e-1 SMART
CA 159 244 3.78e-20 SMART
CA 268 352 1.12e-22 SMART
CA 382 463 5.76e-25 SMART
CA 487 574 2.51e-25 SMART
CA 603 684 8e-3 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 988 1009 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191794
AA Change: D882V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141995
Gene: ENSMUSG00000037892
AA Change: D882V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 51 135 6.6e-4 SMART
CA 159 244 1.9e-22 SMART
CA 268 352 5.6e-25 SMART
CA 382 463 2.7e-27 SMART
CA 487 574 1.2e-27 SMART
CA 603 684 3.9e-5 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193600
Predicted Effect unknown
Transcript: ENSMUST00000194603
AA Change: D414V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195086
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Pcdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Pcdh18 APN 3 49753379 missense probably damaging 1.00
IGL00639:Pcdh18 APN 3 49755616 missense probably benign 0.34
IGL00954:Pcdh18 APN 3 49756389 missense probably damaging 1.00
IGL01338:Pcdh18 APN 3 49756141 missense probably damaging 1.00
IGL01339:Pcdh18 APN 3 49755798 missense probably benign 0.35
IGL01687:Pcdh18 APN 3 49753533 splice site probably benign
IGL01727:Pcdh18 APN 3 49755700 missense probably damaging 0.99
IGL01788:Pcdh18 APN 3 49755922 nonsense probably null
IGL01824:Pcdh18 APN 3 49754774 missense probably damaging 1.00
IGL01834:Pcdh18 APN 3 49756830 missense probably benign 0.03
IGL01913:Pcdh18 APN 3 49755249 missense possibly damaging 0.94
IGL01915:Pcdh18 APN 3 49744921 missense probably benign
IGL02095:Pcdh18 APN 3 49756156 missense probably benign 0.01
IGL02128:Pcdh18 APN 3 49756686 missense possibly damaging 0.65
IGL02302:Pcdh18 APN 3 49755938 missense probably benign
IGL02342:Pcdh18 APN 3 49756044 missense probably damaging 1.00
IGL02440:Pcdh18 APN 3 49744603 utr 3 prime probably benign
IGL02499:Pcdh18 APN 3 49753447 missense probably benign 0.15
IGL02570:Pcdh18 APN 3 49756625 missense probably benign 0.02
IGL02745:Pcdh18 APN 3 49755891 missense probably damaging 1.00
IGL03073:Pcdh18 APN 3 49753367 missense possibly damaging 0.93
PIT4469001:Pcdh18 UTSW 3 49755069 missense probably benign
R0078:Pcdh18 UTSW 3 49756344 missense probably damaging 1.00
R0196:Pcdh18 UTSW 3 49756698 unclassified probably null
R0524:Pcdh18 UTSW 3 49755642 missense probably damaging 0.98
R0661:Pcdh18 UTSW 3 49753318 missense possibly damaging 0.64
R0900:Pcdh18 UTSW 3 49756803 missense probably benign 0.25
R1463:Pcdh18 UTSW 3 49755405 missense probably damaging 0.99
R1778:Pcdh18 UTSW 3 49755634 missense probably benign 0.19
R1850:Pcdh18 UTSW 3 49756405 missense probably benign 0.22
R1875:Pcdh18 UTSW 3 49754705 missense probably damaging 0.99
R1903:Pcdh18 UTSW 3 49755447 missense probably benign
R1956:Pcdh18 UTSW 3 49755951 missense probably benign
R2044:Pcdh18 UTSW 3 49754940 missense probably benign
R2303:Pcdh18 UTSW 3 49755274 missense probably damaging 1.00
R3732:Pcdh18 UTSW 3 49754791 missense probably benign
R3732:Pcdh18 UTSW 3 49754791 missense probably benign
R3733:Pcdh18 UTSW 3 49754791 missense probably benign
R3973:Pcdh18 UTSW 3 49754586 missense probably damaging 1.00
R4281:Pcdh18 UTSW 3 49756533 missense possibly damaging 0.76
R4601:Pcdh18 UTSW 3 49744725 missense probably damaging 1.00
R4631:Pcdh18 UTSW 3 49756441 missense probably damaging 0.99
R4752:Pcdh18 UTSW 3 49755114 missense probably damaging 1.00
R4840:Pcdh18 UTSW 3 49744668 missense probably damaging 0.98
R4867:Pcdh18 UTSW 3 49754664 missense probably damaging 1.00
R5007:Pcdh18 UTSW 3 49754457 missense probably benign 0.23
R5039:Pcdh18 UTSW 3 49754856 missense probably benign
R5169:Pcdh18 UTSW 3 49755966 missense possibly damaging 0.65
R5438:Pcdh18 UTSW 3 49756016 nonsense probably null
R5579:Pcdh18 UTSW 3 49744977 missense probably damaging 1.00
R6000:Pcdh18 UTSW 3 49754464 missense probably damaging 0.99
R6220:Pcdh18 UTSW 3 49745251 missense probably damaging 1.00
R6737:Pcdh18 UTSW 3 49755895 missense probably damaging 0.98
R6789:Pcdh18 UTSW 3 49755915 missense probably benign 0.00
R7011:Pcdh18 UTSW 3 49754782 missense probably benign
R7146:Pcdh18 UTSW 3 49755822 missense probably damaging 1.00
R7150:Pcdh18 UTSW 3 49754694 missense probably benign 0.31
R7205:Pcdh18 UTSW 3 49755474 missense probably benign
R7326:Pcdh18 UTSW 3 49756860 missense probably benign
R7413:Pcdh18 UTSW 3 49744783 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GAAGCATGGGAGAAGCTGTTCGTC -3'
(R):5'- TTCACCAGGGGCAATATCAGCCAC -3'

Sequencing Primer
(F):5'- AGAAGCTGTTCGTCATCCTG -3'
(R):5'- AGCCACGGCCAAGTTTTC -3'
Posted On2014-01-05