Incidental Mutation 'R1101:Plppr5'
ID98070
Institutional Source Beutler Lab
Gene Symbol Plppr5
Ensembl Gene ENSMUSG00000033342
Gene Namephospholipid phosphatase related 5
Synonyms4833424O15Rik, Lppr5
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location117574836-117689507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 117662523 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 231 (M231R)
Ref Sequence ENSEMBL: ENSMUSP00000102081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039564] [ENSMUST00000106473]
Predicted Effect probably damaging
Transcript: ENSMUST00000039564
AA Change: M231R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045121
Gene: ENSMUSG00000033342
AA Change: M231R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 123 267 8.27e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106473
AA Change: M231R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102081
Gene: ENSMUSG00000033342
AA Change: M231R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 123 267 8.27e-20 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type 2 member of the phosphatidic acid phosphatase (PAP) family. All type 2 members of this protein family contain 6 transmembrane regions, and a consensus N-glycosylation site. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Plppr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Plppr5 APN 3 117671943 missense possibly damaging 0.46
IGL01081:Plppr5 APN 3 117686649 utr 3 prime probably benign
IGL01315:Plppr5 APN 3 117662526 missense probably damaging 1.00
IGL02802:Plppr5 UTSW 3 117662579 missense probably damaging 1.00
R0044:Plppr5 UTSW 3 117671889 splice site probably null
R0044:Plppr5 UTSW 3 117671889 splice site probably null
R0332:Plppr5 UTSW 3 117671932 missense probably benign 0.05
R0757:Plppr5 UTSW 3 117575891 missense probably benign 0.16
R1354:Plppr5 UTSW 3 117575847 missense possibly damaging 0.94
R1498:Plppr5 UTSW 3 117662612 missense probably damaging 0.97
R1967:Plppr5 UTSW 3 117625906 critical splice donor site probably null
R2090:Plppr5 UTSW 3 117575871 missense possibly damaging 0.63
R4661:Plppr5 UTSW 3 117620969 missense probably damaging 1.00
R5143:Plppr5 UTSW 3 117625903 missense probably benign
R5441:Plppr5 UTSW 3 117662471 missense possibly damaging 0.94
R5722:Plppr5 UTSW 3 117621065 missense probably benign 0.00
R6560:Plppr5 UTSW 3 117671990 missense probably benign 0.09
R7221:Plppr5 UTSW 3 117620969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACACATGGTTCTCAGTAAGAAATGG -3'
(R):5'- ACAAGCTGTCTCTTAAACCTGCACAT -3'

Sequencing Primer
(F):5'- cacacctttaatcccaacactc -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-01-05