Incidental Mutation 'R1101:Oxtr'
ID98082
Institutional Source Beutler Lab
Gene Symbol Oxtr
Ensembl Gene ENSMUSG00000049112
Gene Nameoxytocin receptor
SynonymsOTR
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location112473683-112489943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112477177 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 42 (R42Q)
Ref Sequence ENSEMBL: ENSMUSP00000145300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053306] [ENSMUST00000075477] [ENSMUST00000204027]
Predicted Effect probably benign
Transcript: ENSMUST00000053306
AA Change: R355Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051132
Gene: ENSMUSG00000049112
AA Change: R355Q

DomainStartEndE-ValueType
Pfam:7tm_4 46 183 2.5e-8 PFAM
Pfam:7TM_GPCR_Srsx 50 339 1.4e-6 PFAM
Pfam:7tm_1 56 328 3.4e-46 PFAM
low complexity region 365 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075477
SMART Domains Protein: ENSMUSP00000074922
Gene: ENSMUSG00000062694

DomainStartEndE-ValueType
Pfam:Caveolin 15 148 9.5e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204027
AA Change: R42Q

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000145300
Gene: ENSMUSG00000049112
AA Change: R42Q

DomainStartEndE-ValueType
SCOP:d1l9ha_ 2 56 2e-6 SMART
Meta Mutation Damage Score 0.1564 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein coupled receptor family and acts as a receptor for oxytocin. Its activity is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. The oxytocin-oxytocin receptor system plays an important role in the uterus during parturition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females fail to lactate and exhibit decreased maternal behavior. Males exhibit an increase in aggression, hypoactivity and vocalization in response to social isolation, and social amnesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Oxtr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02418:Oxtr APN 6 112477239 missense probably damaging 1.00
R0610:Oxtr UTSW 6 112477177 missense probably benign 0.08
R0635:Oxtr UTSW 6 112489200 missense probably damaging 1.00
R0924:Oxtr UTSW 6 112489637 unclassified probably null
R0930:Oxtr UTSW 6 112489637 unclassified probably null
R0959:Oxtr UTSW 6 112477177 missense probably benign 0.08
R0961:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1099:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1102:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1344:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1401:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1682:Oxtr UTSW 6 112477177 missense probably benign 0.08
R2254:Oxtr UTSW 6 112489106 missense probably damaging 0.98
R3424:Oxtr UTSW 6 112477230 missense probably benign 0.31
R3805:Oxtr UTSW 6 112477186 missense probably benign 0.14
R4598:Oxtr UTSW 6 112489752 missense probably benign 0.20
R5757:Oxtr UTSW 6 112477261 missense probably damaging 1.00
R5821:Oxtr UTSW 6 112489496 missense probably damaging 1.00
R6667:Oxtr UTSW 6 112477099 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AATAGGTGGGAGTCCAGGTGATCC -3'
(R):5'- CACCTTGTCTTGTGATCCAGCCAG -3'

Sequencing Primer
(F):5'- AGTCCAGGTGATCCTCTGATG -3'
(R):5'- CCCAGAGTGACACCTGTTC -3'
Posted On2014-01-05