Incidental Mutation 'R1101:4930433I11Rik'
ID98086
Institutional Source Beutler Lab
Gene Symbol 4930433I11Rik
Ensembl Gene ENSMUSG00000091692
Gene NameRIKEN cDNA 4930433I11 gene
SynonymsLOC243944
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location40987543-40995435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40993056 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 141 (T141S)
Ref Sequence ENSEMBL: ENSMUSP00000146117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171664] [ENSMUST00000206529]
Predicted Effect probably benign
Transcript: ENSMUST00000171664
AA Change: T50S

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131120
Gene: ENSMUSG00000091692
AA Change: T50S

DomainStartEndE-ValueType
Pfam:DUF4629 208 354 2.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206360
Predicted Effect probably benign
Transcript: ENSMUST00000206529
AA Change: T141S

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in 4930433I11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02380:4930433I11Rik APN 7 40994544 missense possibly damaging 0.50
FR4304:4930433I11Rik UTSW 7 40993056 small deletion probably benign
FR4340:4930433I11Rik UTSW 7 40993055 small deletion probably benign
FR4342:4930433I11Rik UTSW 7 40993055 small deletion probably benign
FR4548:4930433I11Rik UTSW 7 40993056 small deletion probably benign
R0498:4930433I11Rik UTSW 7 40993294 missense probably benign 0.11
R0610:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0704:4930433I11Rik UTSW 7 40993957 missense probably damaging 1.00
R0723:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0826:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0850:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0862:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0863:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0960:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0961:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0964:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1099:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1167:4930433I11Rik UTSW 7 40993579 missense probably damaging 1.00
R1401:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1429:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1462:4930433I11Rik UTSW 7 40992946 nonsense probably null
R1462:4930433I11Rik UTSW 7 40992946 nonsense probably null
R1816:4930433I11Rik UTSW 7 40994798 nonsense probably null
R1852:4930433I11Rik UTSW 7 40993613 missense probably benign 0.29
R3814:4930433I11Rik UTSW 7 40992919 missense probably damaging 0.99
R4124:4930433I11Rik UTSW 7 40993921 missense probably damaging 1.00
R4823:4930433I11Rik UTSW 7 40993362 missense probably benign 0.00
R5092:4930433I11Rik UTSW 7 40987667 start gained probably benign
R5792:4930433I11Rik UTSW 7 40993521 missense possibly damaging 0.76
R6160:4930433I11Rik UTSW 7 40993526 missense possibly damaging 0.91
R6300:4930433I11Rik UTSW 7 40993461 missense possibly damaging 0.91
R6349:4930433I11Rik UTSW 7 40994772 missense possibly damaging 0.89
R6755:4930433I11Rik UTSW 7 40994310 missense probably damaging 1.00
R6995:4930433I11Rik UTSW 7 40994725 missense probably benign 0.00
R7156:4930433I11Rik UTSW 7 40993858 missense possibly damaging 0.54
R7232:4930433I11Rik UTSW 7 40993179 missense probably damaging 1.00
R7318:4930433I11Rik UTSW 7 40993687 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTTGACTCTTTTGCAGTGGTGGAAAT -3'
(R):5'- CTTTCTCTTCCAGACCCAGGTGGAT -3'

Sequencing Primer
(F):5'- AATGGATACATCCCTGGGATTGTC -3'
(R):5'- CCAAGCTGTCATTGTCAGAAG -3'
Posted On2014-01-05