Incidental Mutation 'R1101:Trim72'
ID98091
Institutional Source Beutler Lab
Gene Symbol Trim72
Ensembl Gene ENSMUSG00000042828
Gene Nametripartite motif-containing 72
Synonymsmitsugumin 53, MG53
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R1101 (G1)
Quality Score150
Status Not validated
Chromosome7
Chromosomal Location128003949-128011033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128010247 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 407 (E407G)
Ref Sequence ENSEMBL: ENSMUSP00000101855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081042] [ENSMUST00000106248]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081042
AA Change: E407G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079832
Gene: ENSMUSG00000042828
AA Change: E407G

DomainStartEndE-ValueType
RING 14 56 5.14e-7 SMART
BBOX 81 122 3.89e-7 SMART
coiled coil region 135 169 N/A INTRINSIC
coiled coil region 204 232 N/A INTRINSIC
PRY 288 341 6.48e-13 SMART
Pfam:SPRY 342 472 4.9e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106248
AA Change: E407G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101855
Gene: ENSMUSG00000042828
AA Change: E407G

DomainStartEndE-ValueType
RING 14 56 5.14e-7 SMART
BBOX 81 122 3.89e-7 SMART
coiled coil region 135 169 N/A INTRINSIC
coiled coil region 204 232 N/A INTRINSIC
PRY 288 341 6.48e-13 SMART
Pfam:SPRY 344 465 1.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206996
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with disruption of this gene display muscle pathologies that develop with age. Mice homozygous for a knock-out allele exhibit enhanced myogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Trim72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Trim72 APN 7 128007964 missense probably damaging 0.97
IGL02538:Trim72 APN 7 128004770 missense probably damaging 1.00
IGL02794:Trim72 APN 7 128004532 missense probably damaging 1.00
IGL03077:Trim72 APN 7 128007841 missense probably benign
H8786:Trim72 UTSW 7 128004791 missense probably damaging 0.99
R1711:Trim72 UTSW 7 128004585 missense probably damaging 1.00
R1826:Trim72 UTSW 7 128007844 missense possibly damaging 0.59
R1853:Trim72 UTSW 7 128009082 missense probably benign 0.01
R1854:Trim72 UTSW 7 128009082 missense probably benign 0.01
R2513:Trim72 UTSW 7 128004706 missense possibly damaging 0.93
R4163:Trim72 UTSW 7 128007908 missense probably benign 0.05
R4587:Trim72 UTSW 7 128007992 missense probably benign 0.21
R5027:Trim72 UTSW 7 128007965 missense probably damaging 0.99
R5067:Trim72 UTSW 7 128009967 missense possibly damaging 0.86
R5276:Trim72 UTSW 7 128004542 missense probably damaging 1.00
R5290:Trim72 UTSW 7 128010004 missense probably benign 0.03
R5339:Trim72 UTSW 7 128010333 missense probably benign
R5410:Trim72 UTSW 7 128009923 missense probably damaging 1.00
R6301:Trim72 UTSW 7 128004614 missense possibly damaging 0.93
R6594:Trim72 UTSW 7 128010048 missense probably damaging 1.00
R6774:Trim72 UTSW 7 128010386 missense probably damaging 1.00
R7162:Trim72 UTSW 7 128007649 missense probably benign 0.18
R7372:Trim72 UTSW 7 128004686 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCAGTTCGACAAGGCAGTAGCG -3'
(R):5'- GACCTAACAAAGGTGGCCTGAGTG -3'

Sequencing Primer
(F):5'- TCACAGGGCGAGCACTATTG -3'
(R):5'- TGGCCTGAGTGATCCCAC -3'
Posted On2014-01-05