Incidental Mutation 'R1101:Lrrfip2'
ID98103
Institutional Source Beutler Lab
Gene Symbol Lrrfip2
Ensembl Gene ENSMUSG00000032497
Gene Nameleucine rich repeat (in FLII) interacting protein 2
Synonyms
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location111117592-111225668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111190225 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 275 (R275W)
Ref Sequence ENSEMBL: ENSMUSP00000149845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035078] [ENSMUST00000098340] [ENSMUST00000196703] [ENSMUST00000196981] [ENSMUST00000197241] [ENSMUST00000197256] [ENSMUST00000198986] [ENSMUST00000200094] [ENSMUST00000216430] [ENSMUST00000217117] [ENSMUST00000217341]
Predicted Effect probably damaging
Transcript: ENSMUST00000035078
AA Change: R109W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035078
Gene: ENSMUSG00000032497
AA Change: R109W

DomainStartEndE-ValueType
Pfam:DUF2051 31 340 2.5e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098340
AA Change: R94W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095944
Gene: ENSMUSG00000032497
AA Change: R94W

DomainStartEndE-ValueType
Pfam:DUF2051 31 326 2.7e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196703
AA Change: R106W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000196981
AA Change: R94W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142851
Gene: ENSMUSG00000032497
AA Change: R94W

DomainStartEndE-ValueType
Pfam:DUF2051 31 350 4.5e-113 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197241
AA Change: R109W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142816
Gene: ENSMUSG00000032497
AA Change: R109W

DomainStartEndE-ValueType
Pfam:DUF2051 31 341 1.3e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197256
AA Change: R131W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143322
Gene: ENSMUSG00000032497
AA Change: R131W

DomainStartEndE-ValueType
Pfam:DUF2051 31 363 2.9e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197540
Predicted Effect probably damaging
Transcript: ENSMUST00000198986
AA Change: R47W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143756
Gene: ENSMUSG00000032497
AA Change: R47W

DomainStartEndE-ValueType
Pfam:DUF2051 10 174 1.9e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200094
AA Change: R94W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142471
Gene: ENSMUSG00000032497
AA Change: R94W

DomainStartEndE-ValueType
Pfam:DUF2051 31 174 4.9e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216430
AA Change: R70W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217117
AA Change: R67W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217341
AA Change: R275W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Lrrfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Lrrfip2 APN 9 111219715 missense probably damaging 1.00
IGL01408:Lrrfip2 APN 9 111214216 missense probably benign 0.11
IGL01462:Lrrfip2 APN 9 111205849 critical splice donor site probably null
IGL01845:Lrrfip2 APN 9 111199660 splice site probably benign
IGL02218:Lrrfip2 APN 9 111219725 missense probably benign
IGL02986:Lrrfip2 APN 9 111161393 splice site probably null
R0091:Lrrfip2 UTSW 9 111214243 missense probably damaging 1.00
R1722:Lrrfip2 UTSW 9 111199761 missense probably damaging 1.00
R2334:Lrrfip2 UTSW 9 111219725 missense probably benign
R2336:Lrrfip2 UTSW 9 111222215 missense probably damaging 1.00
R3103:Lrrfip2 UTSW 9 111222210 missense probably damaging 1.00
R4357:Lrrfip2 UTSW 9 111199687 missense probably damaging 1.00
R5010:Lrrfip2 UTSW 9 111223972 missense possibly damaging 0.79
R5072:Lrrfip2 UTSW 9 111199804 missense probably damaging 1.00
R6026:Lrrfip2 UTSW 9 111214171 missense probably damaging 1.00
R6307:Lrrfip2 UTSW 9 111223953 missense probably damaging 1.00
R6870:Lrrfip2 UTSW 9 111216119 intron probably benign
R7099:Lrrfip2 UTSW 9 111173108 missense probably benign 0.04
R7312:Lrrfip2 UTSW 9 111177457 intron probably null
Predicted Primers PCR Primer
(F):5'- GCTTCAGCAGGTTAGGAACCAAGAC -3'
(R):5'- TGATGCCCATGAACTGGACAGAAAC -3'

Sequencing Primer
(F):5'- CTCCCGTGTTTGAGACCAG -3'
(R):5'- TGAACTGGACAGAAACCCTACTTTG -3'
Posted On2014-01-05