Incidental Mutation 'R1101:Hdac2'
ID98105
Institutional Source Beutler Lab
Gene Symbol Hdac2
Ensembl Gene ENSMUSG00000019777
Gene Namehistone deacetylase 2
SynonymsYy1bp, D10Wsu179e
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location36974544-37001889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36991809 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 184 (V184I)
Ref Sequence ENSEMBL: ENSMUSP00000101149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019911] [ENSMUST00000105510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019911
AA Change: V184I

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019911
Gene: ENSMUSG00000019777
AA Change: V184I

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 321 2.5e-88 PFAM
low complexity region 392 403 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105510
AA Change: V184I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101149
Gene: ENSMUSG00000019777
AA Change: V184I

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 297 8.9e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128031
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the histone deacetylase family. Histone deacetylases act via the formation of large multiprotein complexes, and are responsible for the deacetylation of lysine residues at the N-terminal regions of core histones (H2A, H2B, H3 and H4). This protein forms transcriptional repressor complexes by associating with many different proteins, including YY1, a mammalian zinc-finger transcription factor. Thus, it plays an important role in transcriptional regulation, cell cycle progression and developmental events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and postnatal lethality accompanied with a transient decrease in body size and increase in heart size and cardiomyocyte proliferation that is overcome by 2 months of age in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Hdac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Hdac2 APN 10 36997071 missense probably damaging 1.00
IGL00827:Hdac2 APN 10 36997114 missense probably benign
IGL02971:Hdac2 APN 10 37000374 nonsense probably null
checkmate UTSW 10 36993899 missense probably benign
failure UTSW 10 36989184 missense probably benign 0.16
misstep UTSW 10 36986374 missense possibly damaging 0.59
R0123:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0134:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0167:Hdac2 UTSW 10 37000372 missense probably benign 0.04
R0225:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0455:Hdac2 UTSW 10 36991836 missense probably damaging 1.00
R0480:Hdac2 UTSW 10 36974792 missense probably damaging 1.00
R0482:Hdac2 UTSW 10 36989134 intron probably benign
R0535:Hdac2 UTSW 10 36993899 missense probably benign
R1297:Hdac2 UTSW 10 36986374 missense possibly damaging 0.59
R4839:Hdac2 UTSW 10 36997466 missense probably benign 0.04
R6109:Hdac2 UTSW 10 36986389 missense probably null 0.83
R6447:Hdac2 UTSW 10 36993816 missense possibly damaging 0.95
R6519:Hdac2 UTSW 10 36989256 missense probably damaging 1.00
R6893:Hdac2 UTSW 10 36997007 missense probably damaging 1.00
R7461:Hdac2 UTSW 10 36989236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACTCGATTGTCTTGGTAGCCCG -3'
(R):5'- CTGAACAACAAGCAGCATTCAGTGG -3'

Sequencing Primer
(F):5'- TCTTGGTAGCCCGAGGAGAC -3'
(R):5'- CTGCTCAACTAAGGTGAGGC -3'
Posted On2014-01-05