Incidental Mutation 'R1101:Abi3bp'
ID98136
Institutional Source Beutler Lab
Gene Symbol Abi3bp
Ensembl Gene ENSMUSG00000035258
Gene NameABI gene family, member 3 (NESH) binding protein
SynonymsD930038M13Rik, eratin, TARSH, 5033411B22Rik
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location56477878-56690135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56606158 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 512 (R512L)
Ref Sequence ENSEMBL: ENSMUSP00000156096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048471] [ENSMUST00000096012] [ENSMUST00000096013] [ENSMUST00000171000] [ENSMUST00000231781] [ENSMUST00000231832] [ENSMUST00000231870]
Predicted Effect probably damaging
Transcript: ENSMUST00000048471
AA Change: R512L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036257
Gene: ENSMUSG00000035258
AA Change: R512L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 734 747 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
FN3 941 1024 6.29e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000096012
AA Change: R512L

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093711
Gene: ENSMUSG00000035258
AA Change: R512L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 651 664 N/A INTRINSIC
FN3 841 924 6.29e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000096013
AA Change: R512L

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093712
Gene: ENSMUSG00000035258
AA Change: R512L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
FN3 877 960 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171000
SMART Domains Protein: ENSMUSP00000128818
Gene: ENSMUSG00000035258

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 464 477 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
FN3 671 754 6.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231781
AA Change: R512L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000231832
Predicted Effect possibly damaging
Transcript: ENSMUST00000231870
AA Change: R512L

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Abi3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Abi3bp APN 16 56602805 missense probably null 0.99
IGL01580:Abi3bp APN 16 56675210 missense probably damaging 1.00
IGL01633:Abi3bp APN 16 56677800 missense probably damaging 1.00
IGL01783:Abi3bp APN 16 56532969 critical splice donor site probably null
IGL01866:Abi3bp APN 16 56671973 missense probably benign 0.19
IGL02022:Abi3bp APN 16 56592636 missense probably damaging 1.00
IGL02086:Abi3bp APN 16 56642567 splice site probably benign
IGL02122:Abi3bp APN 16 56687128 splice site probably benign
IGL02155:Abi3bp APN 16 56587964 missense probably damaging 0.99
IGL02351:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02358:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02418:Abi3bp APN 16 56604116 splice site probably benign
IGL02559:Abi3bp APN 16 56687070 nonsense probably null
IGL02617:Abi3bp APN 16 56574444 nonsense probably null
IGL02810:Abi3bp APN 16 56677775 missense probably damaging 1.00
IGL03057:Abi3bp APN 16 56668391 missense possibly damaging 0.95
IGL03174:Abi3bp APN 16 56614747 missense possibly damaging 0.64
R0389:Abi3bp UTSW 16 56671307 missense possibly damaging 0.79
R0485:Abi3bp UTSW 16 56604012 intron probably null
R0557:Abi3bp UTSW 16 56668387 missense probably damaging 0.97
R0616:Abi3bp UTSW 16 56654070 missense probably damaging 0.99
R0685:Abi3bp UTSW 16 56532953 missense possibly damaging 0.90
R0783:Abi3bp UTSW 16 56595238 critical splice acceptor site probably null
R0828:Abi3bp UTSW 16 56677830 missense probably damaging 1.00
R0841:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1078:Abi3bp UTSW 16 56654081 critical splice donor site probably null
R1116:Abi3bp UTSW 16 56686429 splice site probably benign
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1317:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1384:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1460:Abi3bp UTSW 16 56562417 missense probably damaging 0.99
R1730:Abi3bp UTSW 16 56668279 missense possibly damaging 0.62
R1761:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1830:Abi3bp UTSW 16 56587985 missense probably damaging 1.00
R1873:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1875:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1996:Abi3bp UTSW 16 56671357 missense possibly damaging 0.61
R2018:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2019:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2035:Abi3bp UTSW 16 56660218 missense probably benign 0.21
R2118:Abi3bp UTSW 16 56477864 unclassified probably benign
R2202:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R2202:Abi3bp UTSW 16 56650725 nonsense probably null
R2203:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R3030:Abi3bp UTSW 16 56657319 missense possibly damaging 0.79
R3952:Abi3bp UTSW 16 56604038 missense possibly damaging 0.88
R4176:Abi3bp UTSW 16 56652200 missense probably damaging 0.96
R4296:Abi3bp UTSW 16 56668310 missense probably benign 0.05
R4301:Abi3bp UTSW 16 56556903 missense probably damaging 1.00
R4354:Abi3bp UTSW 16 56532951 missense probably benign 0.05
R4417:Abi3bp UTSW 16 56654035 missense probably damaging 1.00
R4716:Abi3bp UTSW 16 56650725 nonsense probably null
R4808:Abi3bp UTSW 16 56594516 missense probably damaging 0.96
R4814:Abi3bp UTSW 16 56650753 missense probably benign 0.06
R5016:Abi3bp UTSW 16 56671268 missense probably damaging 0.97
R5290:Abi3bp UTSW 16 56642475 splice site probably null
R5891:Abi3bp UTSW 16 56606133 missense probably damaging 1.00
R5897:Abi3bp UTSW 16 56604669 missense possibly damaging 0.53
R6146:Abi3bp UTSW 16 56671265 missense probably damaging 0.99
R6267:Abi3bp UTSW 16 56594497 missense probably damaging 0.97
R6905:Abi3bp UTSW 16 56574517 missense probably damaging 1.00
R6908:Abi3bp UTSW 16 56657305 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCATGCTGCTCAGTTACCAGTACC -3'
(R):5'- AGGCTTCAATGCAATGCACATTCAG -3'

Sequencing Primer
(F):5'- ATGCACAGCATGGGCATC -3'
(R):5'- ACACGTTATTGAAGACCCCTG -3'
Posted On2014-01-05