Incidental Mutation 'R1102:Cep350'
ID98142
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission 039175-MU
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1102 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155931518 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 718 (P718S)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124495] [ENSMUST00000138762]
Predicted Effect probably benign
Transcript: ENSMUST00000124495
Predicted Effect probably damaging
Transcript: ENSMUST00000138762
AA Change: P718S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: P718S

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,628 T203M probably damaging Het
1700021F07Rik T A 2: 173,522,723 D20E probably damaging Het
4933416C03Rik T C 10: 116,113,394 S76G probably damaging Het
Acy3 C T 19: 3,987,850 T119I probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Ccdc6 C A 10: 70,187,806 H400Q possibly damaging Het
Ccna1 T C 3: 55,050,860 D134G probably damaging Het
Cct2 A T 10: 117,060,640 probably null Het
Cd36 A G 5: 17,814,213 F170S possibly damaging Het
Ctnna3 A T 10: 64,585,995 I523L probably benign Het
Dnah1 G T 14: 31,296,457 Y1405* probably null Het
Dnah8 T A 17: 30,854,764 probably null Het
Drd3 T C 16: 43,762,483 L113S probably damaging Het
Emsy T C 7: 98,602,589 T735A probably damaging Het
Epha5 A G 5: 84,233,575 probably benign Het
Fbxo10 A G 4: 45,043,672 L717P probably damaging Het
Galnt10 T C 11: 57,781,045 probably benign Het
Gle1 T G 2: 29,944,054 I437M possibly damaging Het
Gm8765 A G 13: 50,703,082 T919A probably benign Het
Gpr137b T C 13: 13,365,031 probably benign Het
Gsta1 T C 9: 78,242,495 F197L probably damaging Het
Icam1 G A 9: 21,027,836 V502M possibly damaging Het
Ido1 T A 8: 24,593,140 I90F probably damaging Het
Il4ra G A 7: 125,574,717 probably null Het
Med12l T A 3: 59,244,836 M1014K probably damaging Het
Mmp13 A G 9: 7,272,952 E104G possibly damaging Het
Mms19 T C 19: 41,950,845 E495G possibly damaging Het
Mrc2 A G 11: 105,340,821 I820V probably benign Het
Naip6 T C 13: 100,304,415 K286E possibly damaging Het
Ndrg1 T C 15: 66,944,836 Y110C probably damaging Het
Olfr1251 A T 2: 89,667,470 C139S probably damaging Het
Olfr1469 G A 19: 13,411,090 V174M probably damaging Het
Olfr1474 T C 19: 13,471,407 C146R probably damaging Het
Olfr376 G A 11: 73,374,874 V45I probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pnpla7 G T 2: 24,996,165 M3I probably damaging Het
Popdc3 A G 10: 45,316,546 probably benign Het
Ppp5c A G 7: 17,022,443 F112S probably benign Het
Rbp3 A G 14: 33,956,356 T754A possibly damaging Het
Reep6 A G 10: 80,335,246 T319A probably benign Het
Rfx3 A G 19: 27,867,600 V43A possibly damaging Het
Rint1 A G 5: 23,805,567 probably benign Het
Sacm1l T G 9: 123,582,298 V384G probably damaging Het
Shox2 A T 3: 66,978,295 L149Q probably damaging Het
Sipa1 T C 19: 5,652,754 H805R probably benign Het
Skiv2l T C 17: 34,840,106 D1095G probably benign Het
Slc5a3 G T 16: 92,077,877 W274L probably damaging Het
Sptbn1 G T 11: 30,120,785 H1524Q possibly damaging Het
Ssr1 G T 13: 37,987,615 Q149K probably benign Het
Thsd7a T C 6: 12,555,702 D61G possibly damaging Het
Tmem245 T C 4: 56,903,200 probably benign Het
Tmem74 T C 15: 43,866,790 T286A probably benign Het
Tnc T C 4: 64,020,468 N45D probably benign Het
Trdmt1 T G 2: 13,523,414 probably benign Het
Uty A T Y: 1,174,741 Y220N probably damaging Het
Vdr T C 15: 97,859,121 Y290C probably damaging Het
Vmn2r19 T A 6: 123,336,173 M734K probably benign Het
Vmn2r53 T C 7: 12,598,483 D413G possibly damaging Het
Vps45 A G 3: 96,042,941 probably benign Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTCCACCTGCATAAGGAATTGACCC -3'
(R):5'- TTCTGTCATGCCAGGATCAAACCC -3'

Sequencing Primer
(F):5'- CATAAGGAATTGACCCTGAGTCTG -3'
(R):5'- AGTTTCTTATGTGCTACTTGACAGC -3'
Posted On2014-01-05