Incidental Mutation 'R1102:Slc5a3'
ID98217
Institutional Source Beutler Lab
Gene Symbol Slc5a3
Ensembl Gene ENSMUSG00000089774
Gene Namesolute carrier family 5 (inositol transporters), member 3
SynonymsSmit1
MMRRC Submission 039175-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1102 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location92058322-92087473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 92077877 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 274 (W274L)
Ref Sequence ENSEMBL: ENSMUSP00000109608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047429] [ENSMUST00000113975] [ENSMUST00000131098] [ENSMUST00000232677]
Predicted Effect probably benign
Transcript: ENSMUST00000047429
SMART Domains Protein: ENSMUSP00000037631
Gene: ENSMUSG00000039680

DomainStartEndE-ValueType
Pfam:Ribosomal_S6 3 95 7.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113975
AA Change: W274L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109608
Gene: ENSMUSG00000089774
AA Change: W274L

DomainStartEndE-ValueType
Pfam:SSF 39 477 1.3e-163 PFAM
transmembrane domain 511 533 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
transmembrane domain 696 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131098
SMART Domains Protein: ENSMUSP00000139098
Gene: ENSMUSG00000089774

DomainStartEndE-ValueType
Pfam:SSF 1 142 3.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232222
Predicted Effect probably benign
Transcript: ENSMUST00000232677
Meta Mutation Damage Score 0.386 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after birth due to respiratory failure and abnormal development of peripheral nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik C T 17: 8,992,628 T203M probably damaging Het
1700021F07Rik T A 2: 173,522,723 D20E probably damaging Het
4933416C03Rik T C 10: 116,113,394 S76G probably damaging Het
Acy3 C T 19: 3,987,850 T119I probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Ccdc6 C A 10: 70,187,806 H400Q possibly damaging Het
Ccna1 T C 3: 55,050,860 D134G probably damaging Het
Cct2 A T 10: 117,060,640 probably null Het
Cd36 A G 5: 17,814,213 F170S possibly damaging Het
Cep350 G A 1: 155,931,518 P718S probably damaging Het
Ctnna3 A T 10: 64,585,995 I523L probably benign Het
Dnah1 G T 14: 31,296,457 Y1405* probably null Het
Dnah8 T A 17: 30,854,764 probably null Het
Drd3 T C 16: 43,762,483 L113S probably damaging Het
Emsy T C 7: 98,602,589 T735A probably damaging Het
Epha5 A G 5: 84,233,575 probably benign Het
Fbxo10 A G 4: 45,043,672 L717P probably damaging Het
Galnt10 T C 11: 57,781,045 probably benign Het
Gle1 T G 2: 29,944,054 I437M possibly damaging Het
Gm8765 A G 13: 50,703,082 T919A probably benign Het
Gpr137b T C 13: 13,365,031 probably benign Het
Gsta1 T C 9: 78,242,495 F197L probably damaging Het
Icam1 G A 9: 21,027,836 V502M possibly damaging Het
Ido1 T A 8: 24,593,140 I90F probably damaging Het
Il4ra G A 7: 125,574,717 probably null Het
Med12l T A 3: 59,244,836 M1014K probably damaging Het
Mmp13 A G 9: 7,272,952 E104G possibly damaging Het
Mms19 T C 19: 41,950,845 E495G possibly damaging Het
Mrc2 A G 11: 105,340,821 I820V probably benign Het
Naip6 T C 13: 100,304,415 K286E possibly damaging Het
Ndrg1 T C 15: 66,944,836 Y110C probably damaging Het
Olfr1251 A T 2: 89,667,470 C139S probably damaging Het
Olfr1469 G A 19: 13,411,090 V174M probably damaging Het
Olfr1474 T C 19: 13,471,407 C146R probably damaging Het
Olfr376 G A 11: 73,374,874 V45I probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pnpla7 G T 2: 24,996,165 M3I probably damaging Het
Popdc3 A G 10: 45,316,546 probably benign Het
Ppp5c A G 7: 17,022,443 F112S probably benign Het
Rbp3 A G 14: 33,956,356 T754A possibly damaging Het
Reep6 A G 10: 80,335,246 T319A probably benign Het
Rfx3 A G 19: 27,867,600 V43A possibly damaging Het
Rint1 A G 5: 23,805,567 probably benign Het
Sacm1l T G 9: 123,582,298 V384G probably damaging Het
Shox2 A T 3: 66,978,295 L149Q probably damaging Het
Sipa1 T C 19: 5,652,754 H805R probably benign Het
Skiv2l T C 17: 34,840,106 D1095G probably benign Het
Sptbn1 G T 11: 30,120,785 H1524Q possibly damaging Het
Ssr1 G T 13: 37,987,615 Q149K probably benign Het
Thsd7a T C 6: 12,555,702 D61G possibly damaging Het
Tmem245 T C 4: 56,903,200 probably benign Het
Tmem74 T C 15: 43,866,790 T286A probably benign Het
Tnc T C 4: 64,020,468 N45D probably benign Het
Trdmt1 T G 2: 13,523,414 probably benign Het
Uty A T Y: 1,174,741 Y220N probably damaging Het
Vdr T C 15: 97,859,121 Y290C probably damaging Het
Vmn2r19 T A 6: 123,336,173 M734K probably benign Het
Vmn2r53 T C 7: 12,598,483 D413G possibly damaging Het
Vps45 A G 3: 96,042,941 probably benign Het
Other mutations in Slc5a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Slc5a3 APN 16 92077631 missense probably damaging 1.00
IGL01100:Slc5a3 APN 16 92079222 intron probably benign
IGL01374:Slc5a3 APN 16 92077118 missense probably benign 0.03
IGL01566:Slc5a3 APN 16 92077577 missense probably damaging 0.99
IGL01615:Slc5a3 APN 16 92079112 nonsense probably null
IGL02489:Slc5a3 APN 16 92077705 missense possibly damaging 0.78
IGL03329:Slc5a3 APN 16 92077460 missense probably damaging 1.00
PIT4449001:Slc5a3 UTSW 16 92077814 missense probably benign
R0054:Slc5a3 UTSW 16 92077634 missense probably damaging 1.00
R0054:Slc5a3 UTSW 16 92077634 missense probably damaging 1.00
R0166:Slc5a3 UTSW 16 92077693 missense possibly damaging 0.73
R1022:Slc5a3 UTSW 16 92077495 missense probably damaging 1.00
R1024:Slc5a3 UTSW 16 92077495 missense probably damaging 1.00
R1635:Slc5a3 UTSW 16 92077396 missense possibly damaging 0.89
R1777:Slc5a3 UTSW 16 92077756 missense probably benign 0.00
R1955:Slc5a3 UTSW 16 92077874 missense possibly damaging 0.46
R2068:Slc5a3 UTSW 16 92077240 missense probably damaging 1.00
R3787:Slc5a3 UTSW 16 92077928 missense possibly damaging 0.82
R4152:Slc5a3 UTSW 16 92077808 nonsense probably null
R4651:Slc5a3 UTSW 16 92077202 missense probably benign 0.26
R4944:Slc5a3 UTSW 16 92078683 missense possibly damaging 0.67
R5008:Slc5a3 UTSW 16 92077281 missense probably damaging 0.96
R6058:Slc5a3 UTSW 16 92079075 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGACTGCTCTGCTGACTGTCACC -3'
(R):5'- AGCTGCAATCATCACTGCCATCATC -3'

Sequencing Primer
(F):5'- TTAAGAGAAGGTACATGTTGGCCTC -3'
(R):5'- AAGGTCATCACCAGGCGTG -3'
Posted On2014-01-05